Labshake search
Citations for Bioline :
701 - 720 of 720 citations for QuantiChrom Aldehyde Dehydrogenase Inhibitor Screening Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: RNA from cell pellets treated with dTAG-13 for four hours was isolated using the Isolate II RNA Mini Kit (Bioline BIO-52072), and 1 μg was converted to cDNA using the qScript cDNA Synthesis Kit (VWR 101414) ...
-
bioRxiv - Cell Biology 2021Quote: ... 500 ng of total RNA from each sample were reverse transcribed to cDNA using the Bioline SensiFAST cDNA Synthesis kit (Bioline, Cat# BIO-65054). The cDNA was diluted 13-fold in ddH2O and 4 uL of this dilution was used for each quantitative real-time PCR (qPCR) ...
-
bioRxiv - Molecular Biology 2021Quote: Ear biopsies from 21 days old mice were digested in MyTaq Extract PCR kit according to the manufacturer (Bioline, Cat number BIO-21126). PCR amplification was performed using the high-fidelity enzyme Q5 from New England Biolab (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... Amplification was carried out in duplicate in 25 µL reactions prepared with 1X SensiFAST™ SYBR® Lo-ROX Kit (Bioline, Meridian Bioscience), 0.4 µL of the forward and reverse primer (IDT ...
-
bioRxiv - Genomics 2021Quote: ... One-step reverse-transcription quantitative PCR (RT-qPCR) was performed with the SensiFAST™ SYBR® No-ROX One-Step kit (Bioline®) on an Eco™ Real-Time PCR System (Ilumina® ...
-
bioRxiv - Immunology 2023Quote: ... Quantitative PCRs (qPCRs) were performed on cDNA samples using SensiFAST™ SYBR® Hi-ROX or SensiFAST™ Probe No-ROX kits (Bioline) on a StepOnePlus real-time PCR apparatus (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative PCR was performed on 6,25ng of cDNA using the SensiFAST™ SYBR® No-ROX kit (Bioline, Meridian Life Science© Company) and a LightCycler® 480 Detection system (Roche) ...
-
bioRxiv - Plant Biology 2023Quote: ... A total of 1 µg of total RNA was used to initiate cDNA synthesis using the SensiFAST™ cDNA Synthesis Kit (Bioline, London, UK). The SYBR Green assay with SensiFAST™ SYBR no ROX kit was used for the quantification of transcripts in RT-PCR ...
-
bioRxiv - Plant Biology 2024Quote: ... cDNAs were diluted to 50 µL and used as template for Real-Time PCR monitored by SensiFast SYBR No-Rox Kit (Bioline, Cincinatti, OH, USA). RT-PCR was performed in the Roche Light Cycler 480 using primers for CAH4 ...
-
bioRxiv - Molecular Biology 2019Quote: ... qRT-PCR was carried out with specific primer sets (listed in Supplementary Table 10) using SensiFAST™ SYBR® No-ROX Kit (BIOLINE, BIO-98005) and CFX Connect Real-Time PCR Detection System (BIO-RAD ...
-
bioRxiv - Microbiology 2021Quote: The origin of viral genes present in samples were determined by gene-specific reverse transcription polymerase chain reaction (RT-PCR) using a SensiFast Probe No-ROX one-step reverse transcription kit (Bioline, Meridian Biosciences, Ohio, USA). Each 20 µL reaction contained 5 μl of virus sample in 0.05% Triton-X 100 ...
-
bioRxiv - Genetics 2022Quote: ... The Endpoint PCR amplification (gDNA concentration of 20-50 ng μl−1 per sample) for each target region were performed using MyFi™ DNA Polymerase Kit (Bioline GmbH, Luckenwalde, Germany) and specific primers (IDENTXX GmbH)in a PCR thermal cycler (T100 PCR thermal cycler ...
-
bioRxiv - Molecular Biology 2022Quote: ... The PCR amplicon band was cut from the gel and isolated by PCR Isolate II PCR and Gel Kit (Bioline, cat. no. BIO-52060) and lastly bead-purified ...
-
bioRxiv - Genomics 2023Quote: ... The PCR product was cut from gel to remove any other undesired products and cleaned with the PCR Isolate II PCR and Gel Kit (Bioline, cat. no. BIO-52060). The isolated samples were sequenced by Illumina MiSeq for screen 1 (14.3 million reads ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNA was synthesized by reverse transcribing 500ng of RNA into cDNA using the SensiFAST™ cDNA Synthesis Kit (Bioline, Meridian Life Science© Company). Quantitative PCR was performed on 6,25ng of cDNA using the SensiFAST™ SYBR® No-ROX kit (Bioline ...
-
bioRxiv - Neuroscience 2019Quote: A 1.0 mm section of caterpillar horn from second-third instar larvae was harvested and placed in a 96-well plate with 10.0 µl of MyTaq™ Extract-PCR Kit Lysis buffer (2 µl Buffer A; 1 µl Buffer B; 7 µl ddH2O, Modified protocol from Bioline; Meridian Life Sciences; United States). Tissue was homogenized using a wet toothpick to quickly press the horn tissue to the side of the well or by cutting the horn multiple times in the lysis buffer ...
-
bioRxiv - Physiology 2021Quote: ... was performed with three primers (Figure 1 A, “a”: AAGGCGCATAACGATACCAC, “b”: TACAATGCAGGCTCCAAACAC, “c”: CGAGCACAGGAAGTTCAACA, Eurofins Genomics, Ebersberg/Germany) and the ImmoMix™ kit (Bioline, Cat. No BIO-25020) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2022Quote: ... Gene expression analysis was performed by quantitative real time PCR (qRT-PCR) with SensiFAST™ SYBR® Lo-ROX Kit (Bioline Reagents Ltd., London, UK) run on the QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Immunology 2021Quote: ... Gene expression analysis was performed by quantitative real time PCR (qRT-PCR) with SensiFAST™ SYBR® Lo-ROX Kit (Bioline Reagents Ltd., London, UK) run on the QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Microbiology 2020Quote: ... The data presented in this study represents serological diagnosis using rapid test kit (SD Bioline dengue IgG/IgM antibody up to 2015; and after 2015, SD Bioline dengue duo (dengue NS1 Ag+ IgG/IgM), Korea ...