Labshake search
Citations for Bioline :
551 - 600 of 994 citations for hsa mir 373 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... with the SensiMix Kit and SYBR Green (Bioline, Luckenwalde, Germany). Negative controls without template addition ...
-
bioRxiv - Neuroscience 2021Quote: ... 5μl SensiFAST SYBR Green No-ROX Kit (BIOLINE, BIO-98020), and 2μl of DNAse/RNAse-free water ...
-
bioRxiv - Microbiology 2021Quote: ... 125nM) and SensiFAST Probe Hi-ROX One-Step Kit (Bioline) according to the manufacturer’s instructions in a 20μl reaction with 5μl sample ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA preparation was performed using SensiFAST cDNA Synthesis Kit (Bioline) and real-time qPCR was performed using SensiFast SYBR Lo-ROX kit (Bioline) ...
-
bioRxiv - Microbiology 2020Quote: ... The Sensi-FAST SYBR Hi-ROX One-Step Kit (Bioline) was used for quantitative real time PCR (qRT-PCR) ...
-
bioRxiv - Physiology 2020Quote: ... SensiFAST™ SYBR® Lo-ROX Kit (Bioline, TN, USA) was used to amplify cDNA using primers listed in Table S2 ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was reverse transcribed using SensiFast cDNA Synthesis Kit (Bioline), and SYBR green PCR analysis was performed using Kapa HiFi HotStart Ready Mix (Roche ...
-
bioRxiv - Physiology 2019Quote: ... reagent and ISOLATE II RNA Mini kit (Bioline, #BIO-52073). Isolated RNA was reverse transcribed using iScript cDNA Synthesis Kit (Biorad ...
-
bioRxiv - Cancer Biology 2019Quote: ... and cDNA was synthesized using SensiFAST cDNA Synthesis kit (Bioline) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: RNA was isolated using ISOLATE II RNA Mini Kit (Bioline) according to the manufacturers’ instructions with minor adjustments ...
-
bioRxiv - Microbiology 2021Quote: ... braarudii cells using the Isolate II RNA Mini Kit (Bioline) with on column DNA digestion ...
-
bioRxiv - Microbiology 2021Quote: ... with Sensi-FAST Probe Hi-ROX qPCR kit (Bioline, 82005) (8).
-
bioRxiv - Immunology 2021Quote: ... using the SensiFAST SYBR No-ROX Kit (Bioline, Meridian Bioscience). Hprt1 was used as a housekeeping gene and the standard curve method was used for quantification ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA was recovered using a DNA purification kit (Bioline #52060). The binding levels of Gal4 and TBP were determined using qPCR ...
-
bioRxiv - Molecular Biology 2022Quote: ... The protocol used the SensiFAST No-ROX kit (Bioline #98020) and a LightCycler 480 system for detection ...
-
bioRxiv - Microbiology 2022Quote: ... was extracted using genomic DNA extraction kit (Bioline, London, UK) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA was synthesized using the SensiFast cDNA synthesis kit (Bioline) and SETD7 and GAPDH levels measured by qPCR were used as positive and negative control respectively ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was reverse transcribed by Tetro cDNA synthesis kit (Bioline) with the primer of ‘GAGCAAAGACCCCAACGAGA’ targeting MBaMV-GFP genome ...
-
bioRxiv - Developmental Biology 2024Quote: ... using the Sensifast SYBR no Rox kit (Bioline, BIO-98020). Data analysis and visualisation was performed using Microsoft Excel (Office 365 ...
-
bioRxiv - Immunology 2023Quote: ... RNA was isolated using ISOLATE II RNA Mini Kit (Bioline) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... and cDNA was synthesized using SensiFAST cDNA Synthesis kit (Bioline). Gene expression was measured using qRT-PCR using TaqMan (Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... and cDNA was synthesized using SensiFAST cDNA Synthesis kit (Bioline). Gene expression was measured using qRT-PCR using TaqMan (Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was isolated using Isolate II RNA Mini Kit (Bioline) and cDNA was synthesized using SensiFAST cDNA Synthesis kit (Bioline) ...
-
bioRxiv - Genomics 2023Quote: ... qPCR was performed using the SensiFAST SYBR NoROX Kit (Bioline) supplemented with 0.2μM of specific primer pairs (Table S9 ...
-
bioRxiv - Neuroscience 2023Quote: ... and reverse transcribed using the SensiFast cDNA Synthesis Kit (Bioline). Quantitative real-time PCR was performed in triplets for each sample using the LightCycler DNA Master SYBR Green I Kit in a LightCycler 480 System (Roche) ...
-
bioRxiv - Cell Biology 2023Quote: ... and cDNA was synthesized using a SensiFast cDNA kit (Bioline) using manufacturer’s instructions from 250 ng of RNA ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA was generated using the Tetro cDNA Synthesis Kit (Bioline) and the Uni12 primer (5’-AGCAAAAGCAGG-3’ ...
-
bioRxiv - Developmental Biology 2024Quote: ... Reactions were performed with SensiFAST SYBR Hi-ROX kit (Bioline), and all samples and negative controls were run in technical duplicate on an Applied Bioscience StepOnePlus qPCR machine (Life Technologies).
-
bioRxiv - Neuroscience 2024Quote: ... and reverse-transcribed with the SensiFASTTM cDNA Synthesis Kit (Bioline) to generate cDNA ...
-
bioRxiv - Microbiology 2024Quote: ... The SensiFAST cDNA synthesis kit (Bioline USA Inc., # BIO-65053) was used to synthesize cDNA from 1 µg RNA ...
-
bioRxiv - Microbiology 2024Quote: ... and SensiFAST probe No-ROX Kit (Bioline Cat # BIO-86005), each 20 µl reaction consisted of ...
-
bioRxiv - Genomics 2020Quote: ... 10 μl of each of the 96 Libraries were separately amplified in 20 μl PCR reactions using MyTaq™ (Meridian Bioline, Memphis, Tennessee, USA) and standard Illumina TrueSeq amplification primers (Illumina ...
-
bioRxiv - Cell Biology 2020Quote: ... qPCR was performed using the SensiFAST SYBR No-ROX Kit (Bioline). Primers used to quantify FLOE1 expression were priqPCRFLOE1set1-FWD/REV (Table S3) ...
-
bioRxiv - Genetics 2021Quote: ... cDNA was synthesized using the SensiFast cDNA synthesis kit (Bioline, USA), and qPCR was done using the SYBR green mix (Bio-Rad ...
-
bioRxiv - Genetics 2021Quote: ... cDNA was synthesized using the SensiFast cDNA synthesis kit (Bioline, USA), and qPCR was done using the SYBR green mix (Bio-Rad ...
-
bioRxiv - Developmental Biology 2021Quote: RNA was isolated using the ISOLATE II RNA Mini Kit (Bioline) following manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2020Quote: ... The SensiMix SYBR No-ROX kit was from Bioline (London, UK). SmaI was from New England Biolabs (Ipswich ...
-
bioRxiv - Molecular Biology 2021Quote: ... a SensiFAST™ SYBR® No-ROX Kit (Bioline, London, UK) was used to perform the qPCR ...
-
bioRxiv - Molecular Biology 2021Quote: qPCRs were performed using SensiFastTM SYBR® Lo-ROX kit (Bioline). A master mix for each primer pair was prepared following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... and column purified using ISOLATE II RNA Mini Kit (Bioline, Australia) according to the manufacturer’s instruction ...
-
bioRxiv - Immunology 2020Quote: RNA was isolated using the ISOLATE II RNA Mini Kit (Bioline) following the manufacturer’s guidelines ...
-
bioRxiv - Cancer Biology 2019Quote: ... Synthesis of cDNA was performed using Sensifast cDNA Synthesis Kit (Bioline) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was reverse transcribed with the Tetro cDNA synthesis kit (Bioline) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 5 μl of 2X SensiFAST SYBR No-ROX kit (Bioline) in a 10 μl total volume ...
-
bioRxiv - Microbiology 2019Quote: ... with the SensiFAST™ SYBR® No-ROX Kit (Bioline, USA). Reaction mix composition was ...
-
bioRxiv - Cell Biology 2021Quote: ... qPCR was performed using SensiFast SYBR Hi-ROX qPCR kit (BioLine). rp49 was used as a housekeeping gene for ΔΔCt calculations ...
-
bioRxiv - Developmental Biology 2020Quote: Total RNA was isolated using Isolate II RNA Mini Kit (Bioline). cDNA was synthesized using SensiFAST cDNA Synthesis Kit (Bioline) ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA synthesis was performed using the Tetro cDNA synthesis kit (Bioline). 2x GoTaq Green master mix (Promega ...
-
bioRxiv - Plant Biology 2021Quote: ... and SensiMix™ SYBR® & Fluorescein Kit (Bioline, Catalog # QT615-05) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... and DNA purification and plasmid isolation kits were obtained from Bioline (Cat#BIO-52060 and Cat#BIO-52057 ...