Labshake search
Citations for Bioline :
501 - 550 of 996 citations for PCR Product Purification kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... The SensiFAST SYBR Lo-ROX Kit (Bioline, #BIO-94020) was utilized for the qRT-PCR ...
-
bioRxiv - Plant Biology 2023Quote: ... using SensiFAST SYBR No-ROS kit (Bioline, BIO-98020) following this program ...
-
bioRxiv - Cell Biology 2023Quote: ... assays and SensiFAST™ Probe Hi-ROX Kit (Bioline) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... assays and SensiFAST™ Probe Hi-ROX Kit (Bioline) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: The Tetro cDNA Synthesis Kit (Bioline; BIO-151 65043) was used to transcribe mRNA into cDNA according to the manufacturer’s manual ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantitative PCR assays were carried out in the 7500 Real Time PCR System from Applied Biosystems using SensiFAST SYBR Lo-ROX Kit (BioLine, London, UK) and primers previously described [7 ...
-
bioRxiv - Pathology 2024Quote: ... or with a Isolate II RNA Mini Kit (Bioline) as per the manufacturers’ instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... followed by cDNA synthesis (SensiFAST cDNA Synthesis Kit, Bioline). Quantitative real time PCR was performed with PowerUp SYBR Master mix in a QuantStudio 6 Pro system ...
-
bioRxiv - Plant Biology 2020Quote: ... and 1 μL of the obtained cDNA was used for real-time PCR with SYBR™ green master mix (Bioline, Luckenwalde, Germany) on a C1000 Touch™ Thermal Cycler (Bio-Rad ...
-
bioRxiv - Plant Biology 2021Quote: ... Real-time quantitative reverse transcriptase PCR (RT-qPCR) was performed using a Biorad CFX384 Optics Module with SensiFAST SYBER No-ROX (Bioline Meridian Biosystems) using gene-specific primers listed in Supplementary Table 1 ...
-
bioRxiv - Microbiology 2020Quote: All PCRs were carried out in 25 μl reaction volumes containing 0.05 units of MyTaq™ DNA Polymerase (Bioline Laboratories, London, UK), 1x MyTaq™ Mix (Bioline ...
-
bioRxiv - Neuroscience 2022Quote: ... was performed on a Qiagen Rotor-Gene Q 2plex real-time PCR cycler with 2x SensiFAST™ SYBR No-ROX mix (Bioline, #98020). Phosphoglycerate kinase 1 (Pgk1 ...
-
bioRxiv - Neuroscience 2022Quote: ... a first-round PCR was carried out using 200 ng of template cDNA with My Taq DNA polymerase (Bioline Alexandria, NSW, Australia), initial denaturation at 95°C for 5 min ...
-
bioRxiv - Microbiology 2023Quote: ... SdhC and SdhD was performed with primers listed in Table 2 and the following reaction conditions: PCR amplification used MyTaq DNA Polymerase (Bioline, London, UK), with 0.25 μM each forward and reverse primer ...
-
bioRxiv - Physiology 2021Quote: ... cDNA products were used as templates for qRT-PCR assessment of gene expression using the SYBR green system (SensiFast™ Sybr No-Rox Mix; Bioline, London, UK) on a Bio-Rad CFX384 Real-Time system instrument (Bio-Rad ...
-
bioRxiv - Cancer Biology 2024Quote: ... Single organoids were hand-picked with capillary pipet tips and examined for locus deletion by PCR using MyTaq™ Red Mix (Bioline, #BIO-25043) and the following cycling parameters ...
-
bioRxiv - Microbiology 2023Quote: ... Indexing PCRs were created by combining 10 μl of purified DNA with 10 μl 2x MyTaq HS Mix polymerase (Bioline, Narellan, NSW, Australia) and 1 μl (5 μM ...
-
bioRxiv - Plant Biology 2020Quote: ... SYBR Green reaction mix (Bioline; Sensimix SYBR No-ROX kit) was used in a Bio-Rad CFX384 real-time system for qPCR ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR was performed using SensiFast SYBR Hi-ROX kit (Bioline) on CFX96 Touch Real-Time PCR System (Bio-Rad) ...
-
bioRxiv - Genetics 2021Quote: ... and cDNA was prepared with Tetro cDNA Synthesis kit (Bioline). qPCR was performed on Applied Biosystems ViiA™ 7 Real-Time PCR System with Sybr Green ...
-
bioRxiv - Neuroscience 2022Quote: ... or the ISOLATE II RNA Mini Kit (Bioline, BIO-52073). Isolated RNA was reverse transcribed using the SensiFAST cDNA Synthesis Kit (Bioline ...
-
bioRxiv - Molecular Biology 2020Quote: ... For RT-qPCR the SensiFAST SYBR Lo-ROX Kit (Bioline) was used ...
-
bioRxiv - Genomics 2020Quote: ... and converted to cDNA using Tetro cDNA synthesis kit (Bioline) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... and reverse transcribed using the SensiFAST cDNA synthesis kit (Bioline), according to manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2020Quote: ... cDNA was transcribed using the SensiFAST cDNA Synthesis Kit (Bioline). Naïve and primed marker expression was determined by qPCR using the Sensifast SYBR No Rox-Kit (Bioline) ...
-
bioRxiv - Cell Biology 2020Quote: ... using the Sensifast SYBR No Rox-Kit (Bioline, BIO-98020). Expression levels were normalized to either L32 or Actin ...
-
bioRxiv - Cell Biology 2020Quote: ... The Sensifast SYBR no-rox Kit (ref. BIO-98005, Bioline) and a Rotor Gene Q Real-Time PCR (Qiagen ...
-
bioRxiv - Bioengineering 2020Quote: ... using the SensiMix™ Kit and SYBRGreen (Bioline, Luckenwalde, Germany). For each triplicate cDNA amounts corresponding to 50 ng RNA were used and measurements were conducted in a LightCycler® 480 (Roche ...
-
bioRxiv - Cancer Biology 2020Quote: ... and SensiMix SYBR No-ROX Kit™ (Bioline, QT650-20), using RPLP0 as a reference gene ...
-
bioRxiv - Cell Biology 2021Quote: ... and the SensiFAST™ SYBR® No-ROX Kit (Bioline), following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNAs were prepared using the SensiFAST cDNA Synthesis Kit (Bioline). Quantitative real-time PCR reactions using cDNA samples as template were carried out using a SensiFAST SYBR No-ROX Kit (Bioline ...
-
bioRxiv - Cancer Biology 2020Quote: ... qPCRs were run using SensiFAST SYBR No-ROX Kit (Bioline) and a Roche LightCycler 384 ...
-
bioRxiv - Plant Biology 2021Quote: ... with the SensiMix Kit and SYBR Green (Bioline, Luckenwalde, Germany). Negative controls without template addition ...
-
bioRxiv - Neuroscience 2021Quote: ... 5μl SensiFAST SYBR Green No-ROX Kit (BIOLINE, BIO-98020), and 2μl of DNAse/RNAse-free water ...
-
bioRxiv - Microbiology 2021Quote: ... 125nM) and SensiFAST Probe Hi-ROX One-Step Kit (Bioline) according to the manufacturer’s instructions in a 20μl reaction with 5μl sample ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA preparation was performed using SensiFAST cDNA Synthesis Kit (Bioline) and real-time qPCR was performed using SensiFast SYBR Lo-ROX kit (Bioline) ...
-
bioRxiv - Microbiology 2020Quote: ... The Sensi-FAST SYBR Hi-ROX One-Step Kit (Bioline) was used for quantitative real time PCR (qRT-PCR) ...
-
bioRxiv - Physiology 2020Quote: ... SensiFAST™ SYBR® Lo-ROX Kit (Bioline, TN, USA) was used to amplify cDNA using primers listed in Table S2 ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was reverse transcribed using SensiFast cDNA Synthesis Kit (Bioline), and SYBR green PCR analysis was performed using Kapa HiFi HotStart Ready Mix (Roche ...
-
bioRxiv - Physiology 2019Quote: ... reagent and ISOLATE II RNA Mini kit (Bioline, #BIO-52073). Isolated RNA was reverse transcribed using iScript cDNA Synthesis Kit (Biorad ...
-
bioRxiv - Cancer Biology 2019Quote: ... and cDNA was synthesized using SensiFAST cDNA Synthesis kit (Bioline) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: RNA was isolated using ISOLATE II RNA Mini Kit (Bioline) according to the manufacturers’ instructions with minor adjustments ...
-
bioRxiv - Microbiology 2021Quote: ... braarudii cells using the Isolate II RNA Mini Kit (Bioline) with on column DNA digestion ...
-
bioRxiv - Microbiology 2021Quote: ... with Sensi-FAST Probe Hi-ROX qPCR kit (Bioline, 82005) (8).
-
bioRxiv - Immunology 2021Quote: ... using the SensiFAST SYBR No-ROX Kit (Bioline, Meridian Bioscience). Hprt1 was used as a housekeeping gene and the standard curve method was used for quantification ...
-
bioRxiv - Molecular Biology 2022Quote: ... The protocol used the SensiFAST No-ROX kit (Bioline #98020) and a LightCycler 480 system for detection ...
-
bioRxiv - Microbiology 2022Quote: ... was extracted using genomic DNA extraction kit (Bioline, London, UK) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA was synthesized using the SensiFast cDNA synthesis kit (Bioline) and SETD7 and GAPDH levels measured by qPCR were used as positive and negative control respectively ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was reverse transcribed by Tetro cDNA synthesis kit (Bioline) with the primer of ‘GAGCAAAGACCCCAACGAGA’ targeting MBaMV-GFP genome ...
-
bioRxiv - Developmental Biology 2024Quote: ... using the Sensifast SYBR no Rox kit (Bioline, BIO-98020). Data analysis and visualisation was performed using Microsoft Excel (Office 365 ...