Labshake search
Citations for GE Life Sciences :
551 - 600 of 1364 citations for WesternBright MCF IR fluorescent Western blotting kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Rv1339 protein was visualized with a FujiFilm LAS-3000 Image Reader and the Amersham™ ECL™ Western Blotting Analysis system (GE Healthcare, UK).
-
bioRxiv - Biochemistry 2023Quote: ... Immunoreactive bands were detected by a FluorChem FC3 System (Protein-Simple, San Jose, CA, USA) after incubation of the membranes with ECL Selected Western Blotting Detection Reagent (GE Healthcare, Pittsburgh, PA, USA). Densitometric analyses of the immunoreactive bands were performed by the FluorChem FC3 Analysis Software.
-
bioRxiv - Physiology 2023Quote: ... Immunoreactive bands were detected using a FluorChem FC3 System (Protein-Simple, San Jose, CA, USA) after the membranes were incubated with ECL Prime Western Blotting Reagent (GE Healthcare, Pittsburgh, PA, USA). Densitometric analysis of the immunoreactive bands was performed using the FluorChem FC3 Analysis Software.
-
bioRxiv - Molecular Biology 2022Quote: ... and ECL prime Western detection kit (Cat. # RPN2232 GE Healthcare, UK)
-
bioRxiv - Cell Biology 2022Quote: ... Western blotting was performed as previously described using Horseradish Peroxidase (HRP)-conjugated secondary antibody followed by addition of ECL (GE Healthcare Bio-Sciences Corp., USA) to reveal chemiluminescence71 ...
-
bioRxiv - Cancer Biology 2019Quote: ... washed three times for 15min using 1x TBS-T and developed using ECL Prime western blotting detection reagent (GE Healthcare Life Sciences, Pittsburgh, PA, USA). Each membrane was imaged using BioRad ChemiDoc and images analyzed using BioRad Image Lab software (BioRad) ...
-
bioRxiv - Physiology 2020Quote: ... Immunoblotting was conducted with specific antibodies and protein bands were visualized using the enhanced chemiluminescence (ECL) Western Blotting Detection System (GE Healthcare, Chalfont St Giles, UK) or the Odyssey infrared detection system (LICOR).
-
bioRxiv - Microbiology 2023Quote: ... as primary antibody and goat anti-mouse-HRP conjugated as secondary antibody and ECL prime Western Blotting Detection chemiluminescent substrate (GE Healthcare, Chicago, IL, United States). The signal was visualized in a Chemidoc MP imaging system (Bio Rad)s).
-
bioRxiv - Biochemistry 2020Quote: ... Gels were imaged with the Amersham IR Typhoon 5 (GE Healthcare) excitation at 685 nm ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The immunoblots were developed using the ECL PrimeWestern blotting detection system kit (GE Healthcare, Milan, Italy). Band intensities were quantified and expressed as optical density on a Gel Doc 2000 Apparatus (Bio-Rad ...
-
bioRxiv - Cell Biology 2023Quote: ... The resulting western-blots were developed using an ECL Prime Kit (GE Healthcare) and detected with an ImageQuant 800 (Amersham).
-
bioRxiv - Biochemistry 2021Quote: ... HRP-conjugated secondary antibodies were detected with WesternBright ECL chemiluminescent HRP substrate using a ImageQuant imaging unit (GE Healthcare). Band intensities for reference protein standards and neuropil extracts were calculated in ImageJ ...
-
bioRxiv - Microbiology 2020Quote: ... Chemoluminescent detection was achieved using an ECL Prime Western Blot detection kit (GE HealthCare). To detect these signals on blotted membranes ...
-
bioRxiv - Pathology 2022Quote: ... and the signal was detected using the ECL western detection kit (RPN2232; GE Healthcare).
-
bioRxiv - Plant Biology 2022Quote: Western Blots were performed as described74 using the ECL Advance detection kit (GE Healthcare). The primary antibody against A ...
-
bioRxiv - Biochemistry 2021Quote: ... samples were transferred after SDS-PAGE via semi-dry blotting (Rab8a) or tank blotting (LRRK2) to 0.45µm nitrocellulose (GE Healthcare). Membranes were blocked with 5 % (w/V ...
-
bioRxiv - Neuroscience 2023Quote: ... membranes were revealed with the ECL-plus chemiluminescence western blot kit (Amersham-GE Healthcare, UK).
-
bioRxiv - Microbiology 2021Quote: ... Fluorescent CFUs were determined by imaging with a Typhoon FLA7000 fluorescent scanner (GE Healthcare).
-
bioRxiv - Neuroscience 2023Quote: ... was used and the fluorescent signal acquired with a Typhoon fluorescent scanner (GE Healthcare). Band intensities were quantified using ImageQuant software (GE Healthcare) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and transferred onto Nitrocellulose Blotting Membrane (GE Healthcare). Membranes were blocked in 5% skim milk (Millipore ...
-
bioRxiv - Cell Biology 2021Quote: ... and blotted onto PVDF Blotting Membranes (GE Healthcare). Membranes were probed with primary antibodies specific for human cyclophilin A (Abcam) ...
-
bioRxiv - Molecular Biology 2022Quote: ... we used a PVDF blotting membrane (GE Healthcare Amersham Hybond P0.45 PVDG membrane 10600023 ...
-
bioRxiv - Developmental Biology 2020Quote: ... and transferred onto Nitrocellulose Blotting Membrane (GE Healthcare). Membranes were incubated with the following primary antibodies overnight at 4°C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... After blotting on a Hybond-P (GE Healthcare) membrane ...
-
bioRxiv - Developmental Biology 2022Quote: ... and transferred onto Nitrocellulose Blotting Membrane (GE Healthcare). Transferred membranes were incubated with the following primary antibodies overnight at 4°C ...
-
bioRxiv - Systems Biology 2024Quote: ... transferred to nitrocellulose blotting membrane (10600004, GE Healthcare), blocked in 5% dry milk and probed for cytosolic (beta-tubulin ...
-
bioRxiv - Biochemistry 2023Quote: ... we used a PVDF blotting membrane (GE Healthcare Amersham Hybond P0.45 PVDG membrane #10600023 ...
-
bioRxiv - Microbiology 2021Quote: Western blotting was carried out using standard methods with semi-dry blotting and the nitrocellulose blots were developed using ECL (GE Healthcare). The images were recorded with a BioRad ChemiDoc MP imager ...
-
bioRxiv - Microbiology 2021Quote: ... and Blots were developed by chemiluminescence based ECL western detection kit (GE Healthcare, cat. no. RPN2236) on Chemidoc™ gel imaging system.
-
bioRxiv - Cell Biology 2019Quote: ... proteins were transferred to nitrocellulose blotting membrane (GE Healthcare). The membrane was blocked with 3% w/v dried skimmed milk (Marvel ...
-
bioRxiv - Cell Biology 2022Quote: ... electroblotted onto a nitrocellulose blotting membrane (Amersham, GE Healthcare) and subjected to immunodetection using appropriate primary antibodies ...
-
bioRxiv - Biochemistry 2019Quote: ... Blotting was done on a nitrocellulose membrane (GE Healthcare). After blocking with TBS buffer supplemented with 0.1 % (v/v ...
-
bioRxiv - Developmental Biology 2022Quote: ... Proteins were transferred to Nitrocellulose blotting membranes (GE Healthcare) at 400 mA for 70 min on ice in cold transfer buffer (25 mM Tris base ...
-
bioRxiv - Developmental Biology 2019Quote: ... and transferred to a Nitrocellulose Blotting membrane (GE Healthcare). Membranes were blocked for 1 hour in 5% milk/TBS-T ...
-
bioRxiv - Biochemistry 2021Quote: ... Blotting was performed on a nitrocellulose membrane (GE Healthcare) using a wet-blot system (BioRad) ...
-
bioRxiv - Cell Biology 2020Quote: ... Proteins were electrotransferred onto nitrocellulose blotting membranes (GE healthcare) and stained with Ponceau Red (Sigma Aldrich) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Blotting was performed onto a nitrocellulose membrane (GE Healthcare) using a Bio-Rad wet blot system ...
-
bioRxiv - Biochemistry 2019Quote: ... IR-ECD was directly applied to a Superdex 200 Increase 300/10 GL column (GE Healthcare) at 0.5 ml/min in HBS at room temperature and the two peak fractions were pooled for ligand binding assays ...
-
bioRxiv - Cancer Biology 2022Quote: ... Detection of peroxidase activity was performed by using the Amersham ECL western blot detection kit (GE Healthcare).
-
bioRxiv - Microbiology 2023Quote: ... Southern blotting to confirm the genotypes were performed using ECL™ Direct Nucleic Acid Labeling and Detection kit (GE Healthcare, USA). Probe (650 bp ...
-
bioRxiv - Cell Biology 2023Quote: Gel-purified PCR products were used to generate radio-labeled probes to detect CLN2 and ACT1 mRNAs by Northern blotting (oligonucleotides: TCAAGTTGGATGCAATTTGCAG, TGAACCAATGATCAATGATTACGT; ACT1 oligonucleotides: TCATACCTTCTACAACGA-ATTGAGA and ACACTTCATGATGGAGTTGTAAGT. Probes were labeled using the Megaprime DNA labelling kits (GE Healthcare). Northern blotting was carried out as previously described (Cross and Tinkelenberg ...
-
bioRxiv - Cell Biology 2022Quote: ... Blotting membranes were developed with standard chemiluminescent solution (GE healthcare) and scanned using Vilber fusion FX 6.0 apparatus (France).
-
bioRxiv - Cell Biology 2023Quote: ... Blotting was performed using either a nitrocellulose (GE Healthcare, USA) or a polyvinylidene difluoride (PVDF ...
-
bioRxiv - Biochemistry 2020Quote: ... Membranes were washed in 1X TBS and developed using the ECL Select Western Blot Detection kit (GE Healthcare) for chemiluminescent detection (Omega Lum G) ...
-
bioRxiv - Genetics 2019Quote: ... ECL substrate (WesternBright Chemilumineszenz Spray, Biozym, Hessisch Oldendorf, DE) was added and signals recorded on an Amersham Hyperfilm™ ECL™ (GE Healthcare, Vienna, A).
-
bioRxiv - Physiology 2022Quote: ... The western blot was developed using Amersham ECL kit Start or Prime (Cat# RPN3243 or # RPN2232, GE life sciences).
-
bioRxiv - Genetics 2020Quote: ... Blots were developed using the ECL plusWestern Blotting System (GE Healthcare).
-
bioRxiv - Immunology 2023Quote: ... separated and transferred to a nitrocellulose blotting membrane (GE Healthcare Amersham). After transfer ...
-
bioRxiv - Biochemistry 2023Quote: ... Fluorescent signals were developed using Typhoon (GE Healthcare). The intensity of the bands was quantified by densitometry using ImageQuant software.
-
bioRxiv - Biochemistry 2020Quote: ... Western blots were detected by ECL (GE Healthcare).