Labshake search
Citations for GE Life Sciences :
701 - 750 of 4395 citations for Recombinant Human ROR2 protein Fc tagged APC labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... precleared with Protein G sepharose (GE Healthcare) for 2 hrs at 4°C and immunoprecipitated overnight with 4 μg of specific antibodies (antibodies listed in Supplementary Table 1) ...
-
bioRxiv - Cell Biology 2021Quote: ... or agarose Protein G beads (GE Healthcare) only ...
-
bioRxiv - Molecular Biology 2022Quote: ... precleared with Protein G sepharose (GE Healthcare) for 2 hours at 4°C and immunoprecipitated overnight with 4 μg of specific antibodies ...
-
bioRxiv - Biochemistry 2023Quote: ... or Protein A HRP (GE Healthcare, NA9120V), all at 1:2500 dilutions (Leng ...
-
bioRxiv - Cell Biology 2023Quote: ... G-protein coupled sepharose beads (GE Healthcare) were pre-washed in lysis buffer and blocked overnight in the lysis buffer with 1% BSA ...
-
bioRxiv - Microbiology 2021Quote: ... Protein-DNA immunocomplexes were retrieved by incubation with 60 µl of equilibrated protein G-conjugated agarose beads (GE Healthcare), for 2 h at 4⁰C ...
-
bioRxiv - Plant Biology 2020Quote: ... Protein extracts were incubated with a rabbit polyclonal anti-HDA15 antibody and protein G Mag Sepharose beads (GE Healthcare) overnight at 4°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... All protein purity was estimated as >95% by SDS-PAGE and protein concentration was measured spectrophotometrically (NanoVue, GE Healthcare). Further details can be found in our previous publication [14].
-
bioRxiv - Microbiology 2023Quote: ... Culture supernatants were clarified followed by protein A affinity chromatography with MabSelect SuRe LX protein A resin (GE Healthcare) using the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... was performed according to a published protocol 63 except that P32-labeled TS primers were used and the signals were quantified on a Phosphor scanner (FLA7000, GE Healthcare). To determine relative telomerase levels between samples ...
-
bioRxiv - Biochemistry 2021Quote: ... All labeled and unlabeled G-actins were further purified by size-exclusion chromatography on Sephacryl S200-HR (GE Healthcare, Chicago, IL), stored on ice in G-buffer ...
-
bioRxiv - Cell Biology 2019Quote: ... The reaction was stopped on ice and labeled polyP300-AF647 was separated from free dye and unlabeled polyP via a NAP-5 column (GE Healthcare) that was equilibrated with 40 mM KPi ...
-
bioRxiv - Bioengineering 2021Quote: ... The reaction mixture was incubated at 37°C for 1 h and labeled EVs purified using a PD-10 size exclusion chromatography column (GE Healthcare). Instant thin layer chromatography (iTLC ...
-
bioRxiv - Molecular Biology 2021Quote: ... The reaction took place for 3 h and the radio labeled kCR probe purified in a Sephadex G25 column (Amersham, GE Healthcare).
-
bioRxiv - Biophysics 2021Quote: ... The amount of recovered protein was determined by fluorescence intensity of the labeled FisB ECD band on the gel using a Typhoon FLA 9500 (GE Healthcare). The dissociation constant Kd was determined following ref ...
-
bioRxiv - Cell Biology 2020Quote: ... The individual TMT labeled samples were pooled and then fractionated using strong cation exchange chromatography on an AKTA Pure 10 (GE Healthcare) equipped with a Luna 5 μm 100 angstrom 150 x 2.1 mm strong cation exchange (SCX ...
-
bioRxiv - Cell Biology 2020Quote: ... Cosmid DNAs that harbor 30-40 kb of sequence around the chosen genomic target were labeled after linearization by nick translation using cy3dUTP (GE Healthcare) as described 93 ...
-
bioRxiv - Cell Biology 2022Quote: ... Bound proteins were visualized using rat anti-HA antibody and detected using peroxidase-labeled anti-rat IgG antibody and ECL Plus (GE Healthcare).
-
bioRxiv - Developmental Biology 2022Quote: ... in presence of 32P end-labeled telomeric primers that has been purified using a micro-spin G-25 column (GE healthcare). PCR reactions were resolved by 9% polyacrylamide gel electrophoresis at room temperature ...
-
bioRxiv - Cell Biology 2019Quote: ... and 3’-primary amino-modified miR-430 MO (5’-TCTACCCCAACTTGATAGCACTTTC-3’) was obtained from Gene tools LLC and labeled with Cy3 NHS-ester (GE Healthcare). After the conjugation for 1 h at room temperature ...
-
bioRxiv - Biochemistry 2019Quote: ... Images of the DNA stained with SYBR Gold and the nascent DNA labeled with Cy5 were obtained with an Amersham Typhoon scanner (GE Healthcare).
-
bioRxiv - Evolutionary Biology 2019Quote: ... 32P-labeled DNA probes containing gag sequences were made by randomly primed DNA synthesis with Amersham Megaprime DNA labeling System (GE Healthcare). gag sequences were amplified by PCR from plasmids pGTy1-H3 (Genbank ...
-
bioRxiv - Cell Biology 2019Quote: ... the primary antibody was visualized using 2~5 μg/ml secondary antibody towards specific species of primary antibody labeled with Cy3B (GE Healthcare) or Atto 488 (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2021Quote: ... A radioactively labeled probe corresponding to the coding region of TbGPI2 was generated using a Megaprime DNA-labeling system (GE Healthcare) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: A total of 1.5 mg each of 0 hr and 3 or 5 hr ssDNA samples were labeled with Cy3-dUTP or Cy5-dUTP (GE Healthcare) by random priming without denaturation with 4 mg random nonamer oligo (Integrated DNA Technologies ...
-
bioRxiv - Biochemistry 2021Quote: ... The reaction was inactivated at 75 °C for 10 min and the labeled RNA/DNA was purified by gel filtration (Illustra MicroSpin G-25 columns; GE Healthcare). Recombinant ...
-
bioRxiv - Cancer Biology 2020Quote: ... the reaction was quenched by addition of the same EDTA solution and the labeled construct was purified using gel-filtration chromatography (Sephadex G-25, PD10 desalting column; GE Healthcare) into 0.9% saline ...
-
bioRxiv - Molecular Biology 2021Quote: ... The cap-labeled RNA was then purified from unincorporated nucleotides by using a ProbeQuant G-50 gel filtration column (GE Healthcare).
-
bioRxiv - Molecular Biology 2022Quote: ... the membrane was hybridized with a random-primed 32P-labeled specific probe using Amersham™ Megaprime kit (GE Healthcare, Cat# RPN1607). The probe was obtained from a 1.45 kb PCR product (primers list in Table S3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5% dextran sulfate) at 65°C probed with 32P-labeled CLB3 DNA probes prepared via Amersham Megaprime DNA labeling kit (GE Healthcare) and Illustra ProbeQuant columns (GE Healthcare) ...
-
bioRxiv - Cell Biology 2023Quote: Gel-purified PCR products were used to generate radio-labeled probes to detect CLN2 and ACT1 mRNAs by Northern blotting (oligonucleotides: TCAAGTTGGATGCAATTTGCAG, TGAACCAATGATCAATGATTACGT; ACT1 oligonucleotides: TCATACCTTCTACAACGA-ATTGAGA and ACACTTCATGATGGAGTTGTAAGT. Probes were labeled using the Megaprime DNA labelling kits (GE Healthcare). Northern blotting was carried out as previously described (Cross and Tinkelenberg ...
-
bioRxiv - Molecular Biology 2021Quote: ... column for Notch1fe (human version) or a Superdex 10/300 increase (GE Healthcare) column for Jagged1fe,HA and Notch1NRR ...
-
bioRxiv - Microbiology 2020Quote: Neutrophils isolated from fresh human blood using a Ficoll-Paque PLUS (GE Healthcare) gradient were resuspended in medium at a concentration of 5 × 106 cells/mL ...
-
bioRxiv - Cell Biology 2019Quote: ... human adult blood was collected and immune cells purified by Ficoll (GE healthcare). Mice were injected intravenously with 1×107 freshly isolated PBMCs or NK-depleted PBMCs obtained from the negative fraction of a positive selection (CD56+ ...
-
bioRxiv - Genomics 2024Quote: ... Human peripheral blood mononuclear cells (PBMCs) were isolated by Ficoll-Paque (GE Healthcare) density centrifugation from buffy coats (American Red Cross ...
-
bioRxiv - Microbiology 2020Quote: ... proteins were immobilized to a protein A sensorchip a level of ~500 response units (RUs) using Biacore 8000 (GE Healthcare) and a running buffer of composed of 20mM PB7.4 with 300 mM NaCl ...
-
bioRxiv - Biophysics 2021Quote: ... Protein was purified via its C-terminal green fluorescence protein (GFP) tag using GFP nanobody coupled Sepharose Beads (GE Healthcare) and eluted by removing the GFP tag with the PreScission Protease ...
-
bioRxiv - Biophysics 2019Quote: The proteins and protein complexes were analyzed by analytical gel filtration using a Superdex 200 5/150 column (GE Healthcare) and the 1260 Infinity Bio-inert high-performance liquid chromatography system (Agilent Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... The protein absorbance at 280 nm was monitored to detect protein elution on an AKTA system (GE Healthcare Life Sciences). The eluted fractions were collected for SDS-PAGE analysis.
-
bioRxiv - Biochemistry 2022Quote: ... Cleaved protein was further purified by fast protein liquid chromatography (FPLC) using a Source-S cation-exchange column (GE Healthcare) (low salt buffer with 50 mM potassium phosphate at pH 7.0 ...
-
bioRxiv - Zoology 2021Quote: ... Visualization of identified total protein and phosphorylated protein bands was completed using an Amershan ECL Plus detection kit (GE Healthcare) as per manufacturer’s instructions (Figure A1 ...
-
bioRxiv - Immunology 2021Quote: ... The supernatant was then loaded onto the protein A column and the target protein was eluted with 0.1 M acetic acid on ÄKTA pure (GE Healthcare). The collected protein was added to 1 mM Edetate disodium (EDTA) ...
-
bioRxiv - Developmental Biology 2021Quote: ... The remaining supernatant was added to 50 µl G-Protein Sepharose beads (Protein G-Sepharose 4 Fast Flow, GE Healthcare) (pre-washed with the lysis buffer ...
-
bioRxiv - Bioengineering 2021Quote: ... Protein G-coupled sepharose (#17–0618–01) and Protein A-coupled sepharose (#17–5138–01) beads were from GE Healthcare and the protease inhibitor cocktail was from Sigma.
-
bioRxiv - Microbiology 2020Quote: ... Proteins of interest were detected with protein-specific primary antibodies and HRP-coupled secondary antibodies by enhanced chemiluminescence (GE Healthcare) and imaged using X-ray films or with Fusion Capture Advance FX7 16.15 (Peqlab).
-
bioRxiv - Biophysics 2023Quote: ... Protein was purified via its C-terminal green fluorescence protein (GFP) tag using GFP nanobody-coupled Sepharose beads (GE Healthcare) and eluted by removing the GFP tag with PreScission Protease ...
-
bioRxiv - Biophysics 2021Quote: ... Protein-transferred PVDF membranes (GE Healthcare Life Science) were blocked with 5% skim milk in PBS-T ...
-
bioRxiv - Biophysics 2021Quote: ... proteins were visualized using ECL prime (GE Healthcare).
-
bioRxiv - Cell Biology 2020Quote: M-PER mammalian protein extraction reagent (GE Healthcare) was used to extract protein from mOSE cells and run on NuPAGE 4-12% Bis-Tris gradient gels (Life Technologies).
-
bioRxiv - Developmental Biology 2021Quote: ... antibodies and protein G Mag sepharose (GE Healthcare) overnight at 4°C ...