Labshake search
Citations for GE Life Sciences :
551 - 600 of 669 citations for QuantiChrom β Glucosidase Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... All blots were washed 4X with PBS-T and then developed with a Amersham ECL Western Blotting Detection Kit (GE Healthcare).
-
bioRxiv - Developmental Biology 2020Quote: ... 5 μg of total RNA was used to synthesize the first-strand cDNA using the First-Strand cDNA synthesis kit (GE Healthcare) with a pd(N)6 primer ...
-
bioRxiv - Microbiology 2019Quote: ... One microliter of the RT product was taken as a template for each of the three independent multiple displacement amplification (MDA) reactions performed with the Illustra GenomiPhi V2 kit (GE Healthcare). This was done to compensate for the random amplification bias ...
-
bioRxiv - Cell Biology 2019Quote: ... The column was calibrated with protein standards of known molecular weight and stokes’ radius (Low and High Molecular Weight Kit, GE Healthcare) according to manufacturer’s protocol.
-
bioRxiv - Genomics 2019Quote: ... Signals were detected by the HyGLO HRP detection kit (Denville Scientific) and exposed to Amersham Hyperfilm ECL (GE Healthcare Life Science).
-
bioRxiv - Microbiology 2021Quote: ... Protein size was analyzed using a calibration curve of proteins included in the high molecular weight calibration kit (GE Healthcare, Chicago). To test frozen samples for aggregation ...
-
bioRxiv - Biochemistry 2021Quote: ... The oligomerization state was determined by comparison of the elution volumes to the calibration curve of the column (Gel Filtration Calibration Kit, GE Healthcare). The fraction corresponding to the tetradecamer peak was analyzed by intact protein mass spectrometry ...
-
bioRxiv - Neuroscience 2020Quote: ... membranes were treated with peroxidase-conjugated secondary antibodies for 2h at room temperature and revealed using a chemiluminescence detection kit (ECL, GE Healthcare).
-
bioRxiv - Biochemistry 2021Quote: ... were loaded with 10 μL of Aβ42 oligomer samples alongside the Amersham High Molecular Weight calibration kit for native electrophoresis (GE Healthcare, USA). The gels were run at 4 °C using the electrophoresis system according to the Invitrogen instructions (ThermoFisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: ... The solution was neutralized by adding 1 M HCl and the cDNA was purified with the illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare). The 5’-3’ junction sequence was amplified by PCR with cox1 specific primers Atcox1-5’(−176..-196 ...
-
bioRxiv - Microbiology 2020Quote: ... a CM5 sensor chip was immobilized with a mouse anti-human IgG CH2 mAb using reagents and instructions supplied with the Human Antibody Capture Kit (GE Healthcare) in order to capture RBD-Fc or ACE2-Fc ...
-
bioRxiv - Microbiology 2020Quote: ... The standard calibration curve was obtained using combined low molecular weight (LMW) and high molecular weight (HMW) Gel filtration Calibration kits (GE Healthcare). The resulting peaks from the elution of the protein were fractionated in 0.5 ml ...
-
bioRxiv - Plant Biology 2020Quote: ... the membrane was washed three times with 1X TBST and processed with a LAS-4000 luminescent image analyzer (Fujifilm) after incubation with the ECL Prime enhanced chemiluminescence kit (GE Healthcare).
-
bioRxiv - Microbiology 2021Quote: ... Protein samples were separated on SDS-PAGE and transferred onto PVDF membrane and visualized using ECL Western Blotting Detection Kit (GE Healthcare). The primary antibodies used in this study were mouse anti-HA (1:2000 ...
-
bioRxiv - Evolutionary Biology 2021Quote: PCR products of the expected size (359 bp) yielding ≥ 20 ng were cleaned using ExoSAP-IT PCR Clean-up Kits (GE Healthcare). In cases where the yield of PCR products was lower than this threshold ...
-
bioRxiv - Microbiology 2020Quote: ... Mouse anti-human Fc monoclonal antibody R10Z8E9 was immobilised onto active and reference flow cells of a Series S sensor CM5 chip using an amine capture kit (both from GE Healthcare). Approximately 1000 response units of Pf34 bait protein was captured onto the active flow cell ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR products were cleaned with an Illustra GFX PCR DNA and gel band purification kit (GE Healthcare, Chicago, IL, USA) and sequenced by using Sanger technology in an ABI 3730XL sequencer (STAB-VIDA ...
-
bioRxiv - Biophysics 2022Quote: ... Protein concentration of the extracts were determined by SDS-PAGE and densitometry analysis using the LMW-SDS Marker Kit (GE Healthcare) as standard.
-
Loss of TREM2 reduces hyperactivation of progranulin deficient microglia but not lysosomal pathologybioRxiv - Neuroscience 2021Quote: ... Biacore Series S CM5 sensor chip was immobilized with a mixture of two monoclonal mouse anti-Fab antibodies (Human Fab capture kit from GE Healthcare) to capture antibodies for binding measurements ...
-
bioRxiv - Neuroscience 2021Quote: ... Bands were detected using HRP-labelled anti-rabbit IgG and developed using an enhanced luminescence kit (GE Healthcare #GENA934, Watford, UK). Beta actin (Sigma #A5316 ...
-
bioRxiv - Microbiology 2021Quote: ... an aliquot of each DNA sample underwent whole genome amplification with the Illustra Ready-To-Go GenomiPhi V3 DNA Amplification Kit (GE Healthcare) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: Genomic DNA was extracted from 1 ml overnight bacterial culture using the Illustra bacteria genomicPrep Mini Spin Kit (GE Healthcare, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Samples of both male and female livers from all the different treatments (N=6-8) were individually used to isolate total RNA via the Illustra RNAspin Mini RNA Isolation kit (GE Healthcare), according to the manufacturer’s standard protocol ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Proteins were detected by fluorescence (Odyssey, Li-Cor) or revealed using the ECL Prime Western Blotting Detection Reagent kit (GE Healthcare) and images were acquired in a dark room using a G:Box (Syngene ...
-
bioRxiv - Microbiology 2022Quote: ... DNA from PCRs and agarose gels was purified using the Illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare). Polymerases ...
-
bioRxiv - Evolutionary Biology 2022Quote: Recombinant pGEM-T easy vectors used to sequence the lncov1 full-length were digested with EcoRI (Fermentas) and purified again with the Illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare). In vitro reverse transcription was performed using the RiboMax T7 system (Promega ...
-
bioRxiv - Zoology 2019Quote: The midgut BBMV proteins were subjected to clean-up using the 2-D Clean-up Kit (GE Healthcare Life Sciences, USA) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... phenolics and nucleic acids in extracted protein were removed using the 2-D Clean-Up kit (GE Healthcare, Piscataway, NJ, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... The PCR product was gel purified by Illustra GFX PCR DNA and Gel Band Purification Kits (GE Healthcare, Chicago, Illinois, USA), cloned into pJET 1.2/blunt vector (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2019Quote: ... as capture molecule to the dextran surface of both flow cells of a CM5 Chip (GE Heathcare) using an amine coupling kit (GE healthcare). GST tagged ligand proteins were captured on the detection flow cell of the chip and free GST was captured on the reference flow cell ...
-
bioRxiv - Microbiology 2020Quote: ... blocked for 1 hour and immuno-detected using Anti-RecA (E. coli) antibody (1000x dilution) (gift from Mike Cox, (52)) and analyzed using an ECL Prime detection kit (GE Healthcare). Densitometry was performed using ImageJ (https://imagej.nih.gov/ij/)
-
bioRxiv - Microbiology 2021Quote: ... between 400 to 600 RU of biotinylated anti-IFX monoclonal antibodies were immobilised on a streptavidin-coated sensor chip prepared using the Biotin CAPture kit (GE Healthcare); a biotinylated mouse monoclonal antibody (OX68 ...
-
bioRxiv - Immunology 2019Quote: ... rVACV-eGFP-OVA-Early and rVACV-eGFP-OVA-Late were generated by transfecting plasmid DNA into BSC-1 cells infected with VACV-vRB21 at an MOI of 1 using the CellPhect Transfection Kit (GE Healthcare). The resulting rVACVs were plaque-purified 3× prior to characterization ...
-
bioRxiv - Microbiology 2019Quote: ... DNA was excised from the gels and extracted using the Illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Radiolabeled probes were typically generated by random priming of PCR products covering the regions of interest with Megaprime kit (GE Healthcare) in the presence of α-32P dCTP (3000 Ci/mmol) ...
-
bioRxiv - Genomics 2021Quote: Genomic DNA was extracted from rosette leaves of one individual plant using the Nucleon Phytopure genomic DNA extraction kit (GE Healthcare), and whole genome bisulfite sequencing (WGBS ...
-
bioRxiv - Cell Biology 2020Quote: ... A probe was generated from a PCR fragment homologous to the 3’ sequence just outside of the targeted region using the AlkPhos direct labelling kit (GE Healthcare) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... membranes were washed and revealed using a commercial kit (Pierce ECL Western Blotting Substrate, Thermo Fischer) and photos were taken by the ImageQuant LAS 4000 mini (GE Healthcare) camera system ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... DNA was extracted from each sample along with the RNA as per manufacturer instructions and amplified using a whole genome amplification kit (illustra GenomePhi v2, GE Healthcare). Sex-specific primers (Table S1 ...
-
bioRxiv - Microbiology 2021Quote: ... All blots were washed 4X with PBS-T and then developed with a Amersham ECL Western Blotting Detection Kit (GE Healthcare).
-
bioRxiv - Biochemistry 2022Quote: ... secondary antibodies were incubated for 2 h at room temperature and visualized on X-ray films using enhanced chemiluminescence detection kit (GE Healthcare).
-
bioRxiv - Plant Biology 2022Quote: ... of leaf tissues from M15 plants grown outside under low light conditions using the illustra Nucleon Phytopure Genomic DNA Extraction Kit (GE Healthcare) after grinding the leaves in liquid nitrogen to a fine powder ...
-
bioRxiv - Microbiology 2023Quote: ... Southern blotting to confirm the genotypes were performed using ECL™ Direct Nucleic Acid Labeling and Detection kit (GE Healthcare, USA). Probe (650 bp ...
-
bioRxiv - Molecular Biology 2023Quote: ... These primary antibodies were detected using HRP conjugated anti-mouse and anti-rabbit IgGs and the ECL detection kit (all from GE Healthcare). Band intensities were quantified by densitometric analysis with Image Lab software (Bio-Rad).
-
bioRxiv - Molecular Biology 2022Quote: ... the membrane was hybridized with a random-primed 32P-labeled specific probe using Amersham™ Megaprime kit (GE Healthcare, Cat# RPN1607). The probe was obtained from a 1.45 kb PCR product (primers list in Table S3 ...
-
bioRxiv - Molecular Biology 2022Quote: The samples were purified using a minicolumns GFX PCR DNA & gel band purification kit (GE Healthcare Bio-Sciences AB Uppsala, Sweden) according to a previously described protocol (https://dx.doi.org/10.17504/protocols.io.brzpm75n) ...
-
bioRxiv - Molecular Biology 2022Quote: ... the PCR amplified eleven positive virus genomes were amplified by RCA (rolling circle amplification) using the RCA-based TempliPhi DNA amplification kit (GE Healthcare) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5% dextran sulfate) at 65°C probed with 32P-labeled CLB3 DNA probes prepared via Amersham Megaprime DNA labeling kit (GE Healthcare) and Illustra ProbeQuant columns (GE Healthcare) ...
-
bioRxiv - Cell Biology 2023Quote: Gel-purified PCR products were used to generate radio-labeled probes to detect CLN2 and ACT1 mRNAs by Northern blotting (oligonucleotides: TCAAGTTGGATGCAATTTGCAG, TGAACCAATGATCAATGATTACGT; ACT1 oligonucleotides: TCATACCTTCTACAACGA-ATTGAGA and ACACTTCATGATGGAGTTGTAAGT. Probes were labeled using the Megaprime DNA labelling kits (GE Healthcare). Northern blotting was carried out as previously described (Cross and Tinkelenberg ...
-
bioRxiv - Plant Biology 2023Quote: ... DNA was isolated from leaf tissue of 4-wk-old plants by using Illustra Nucleon Phytopure extraction kit reagents (GE Healthcare). DNA was isolated from agarose gel pieces using QIAquick gel extraction kit (Qiagen).