Labshake search
Citations for GE Life Sciences :
551 - 600 of 629 citations for Multiplex Assay kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... secondary antibodies were incubated for 2 h at room temperature and visualized on X-ray films using enhanced chemiluminescence detection kit (GE Healthcare).
-
bioRxiv - Plant Biology 2022Quote: ... of leaf tissues from M15 plants grown outside under low light conditions using the illustra Nucleon Phytopure Genomic DNA Extraction Kit (GE Healthcare) after grinding the leaves in liquid nitrogen to a fine powder ...
-
bioRxiv - Microbiology 2023Quote: ... Southern blotting to confirm the genotypes were performed using ECL™ Direct Nucleic Acid Labeling and Detection kit (GE Healthcare, USA). Probe (650 bp ...
-
bioRxiv - Molecular Biology 2023Quote: ... These primary antibodies were detected using HRP conjugated anti-mouse and anti-rabbit IgGs and the ECL detection kit (all from GE Healthcare). Band intensities were quantified by densitometric analysis with Image Lab software (Bio-Rad).
-
bioRxiv - Molecular Biology 2022Quote: ... the membrane was hybridized with a random-primed 32P-labeled specific probe using Amersham™ Megaprime kit (GE Healthcare, Cat# RPN1607). The probe was obtained from a 1.45 kb PCR product (primers list in Table S3 ...
-
bioRxiv - Molecular Biology 2022Quote: The samples were purified using a minicolumns GFX PCR DNA & gel band purification kit (GE Healthcare Bio-Sciences AB Uppsala, Sweden) according to a previously described protocol (https://dx.doi.org/10.17504/protocols.io.brzpm75n) ...
-
bioRxiv - Molecular Biology 2022Quote: ... the PCR amplified eleven positive virus genomes were amplified by RCA (rolling circle amplification) using the RCA-based TempliPhi DNA amplification kit (GE Healthcare) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5% dextran sulfate) at 65°C probed with 32P-labeled CLB3 DNA probes prepared via Amersham Megaprime DNA labeling kit (GE Healthcare) and Illustra ProbeQuant columns (GE Healthcare) ...
-
bioRxiv - Cell Biology 2023Quote: Gel-purified PCR products were used to generate radio-labeled probes to detect CLN2 and ACT1 mRNAs by Northern blotting (oligonucleotides: TCAAGTTGGATGCAATTTGCAG, TGAACCAATGATCAATGATTACGT; ACT1 oligonucleotides: TCATACCTTCTACAACGA-ATTGAGA and ACACTTCATGATGGAGTTGTAAGT. Probes were labeled using the Megaprime DNA labelling kits (GE Healthcare). Northern blotting was carried out as previously described (Cross and Tinkelenberg ...
-
bioRxiv - Plant Biology 2023Quote: ... DNA was isolated from leaf tissue of 4-wk-old plants by using Illustra Nucleon Phytopure extraction kit reagents (GE Healthcare). DNA was isolated from agarose gel pieces using QIAquick gel extraction kit (Qiagen).
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCR products amplified with primers Aeatro-Nix-F1/R1 were purified with GFX PCR DNA and Gel Band Purification Kit (GE Healthcare) and cloned into pJET1.2/blunt cloning vector ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCR products amplified with primers Aeatro-Nix-F2/R2 were purified with GFX PCR DNA and Gel Band Purification Kit (GE Healthcare) and directly sequenced.
-
bioRxiv - Biochemistry 2022Quote: ... The antibodies were captured on a CM5 chip immobilized with anti-human IgG Fc using a Human Antibody Capture Kit (GE Healthcare), according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: Proteins from the samples were purified by a modified trichloroacetic acid protein precipitation procedure (Clean-Up Kit; GE Healthcare, Munich, Germany), and gel-assisted proteolysis was carried out ...
-
bioRxiv - Biophysics 2023Quote: ... were loaded with 10 μL of Aβ42 oligomer samples alongside the Amersham High Molecular Weight calibration kit for native electrophoresis (GE Healthcare, USA). The gels were run at 4°C using the electrophoresis system according to the Invitrogen instructions (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... An Fc capture chip was produced by amine coupling of anti-mouse IgG antibody to a CM5 chip using a commercial Fc Capture Kit (GE Healthcare). First ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we introduced random mutations with Multi Primed Rolling Circle Amplification using the Illustra™ TempliPhi™ DNA Amplification Kit (GE Healthcare) with 2 mM of MnCl2 added to a final reaction volume of 10.8 µl ...
-
bioRxiv - Plant Biology 2024Quote: ... Immunodetection was performed using an ECL Plus Western Detection Kit and revealed with an ImageQuant LAS 4000 mini CCD camera system (GE Healthcare). ImageJ was used for quantifications of the bands.
-
bioRxiv - Neuroscience 2024Quote: ... RNA (5 μg) was used to synthesize the first-strand complementary DNA (cDNA) using the First-Strand cDNA synthesis kit (GE Healthcare) with a pd(N)6 primer following the manufacturer’s indications ...
-
bioRxiv - Physiology 2022Quote: ... at a dilution of 1:2000 was done for 1 hour at RT in blocking buffer and detection was done using ECL detection kit (RPN2235, GE Healthcare, USA). Images were taken by the ImageQuant LAS500 (GE healthcare ...
-
bioRxiv - Genetics 2020Quote: ... High molecular weight DNA from concentrated coral sperm was extracted using the illustra Nucleon Phytopure kit (GE Healthcare Life Science, Pittsburgh, PA) following the manufacturer’s instructions and eluted in nuclease-free water ...
-
bioRxiv - Cell Biology 2019Quote: ... 6His-Cdc11-SNAP was biotinylated with BG-Biotin and subsequently immobilized on a CAP chip (Biotin Capture Kit; GE Healthcare, Freiburg, Germany). Preparation of the chip ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA from brain tissues or culture cells were extracted using the illustra RNAspin Mini RNA Isolation Kit (GE Healthcare Life Sciences) for reverse transcription with the High-Capacity cDNA Reverse Transcription Kits (ABI Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... according to manufacturer’s instructions and circular DNA was enriched by rolling circle amplification (RCA) with TempliPhi™ amplification kit (GE Healthcare, USA).
-
bioRxiv - Cancer Biology 2022Quote: ... Membranes were further washed three times for five minutes in PBS-T before being visualised using ECL kit (GE Healthcare Cat. #RPN2232) and ChemiDoc Imaging System (BioRad) ...
-
bioRxiv - Cell Biology 2022Quote: ... Equal amounts of protein samples were subjected to immunoblotting for target proteins and immunoreactive bands were visualized using the Amersham ECL western blotting detection kit according to the manufacturer’s protocol (GE Healthcare, Piscataway, NJ). Antibodies for GAPDH or Cyclophilin B were used as loading controls.
-
bioRxiv - Genomics 2019Quote: ... and whole genome amplification was achieved by multiple displacement amplification with Phi29 DNA polymerase and the Illustra GenomiPhi v.2 kit (GE Healthcare, 25660032). Amplified genomic DNA (70 ng ...
-
bioRxiv - Molecular Biology 2019Quote: ... random hexamer primers were used following the manufacturer’s instructions for the GenomiPhi V2 DNA Amplification Kit (catalogue # 45-001-221, GE Healthcare Life Sciences).
-
bioRxiv - Genetics 2020Quote: We performed WGA on each F2 gDNA cercarial sample using the Illustra GenomiPhi V2 DNA Amplification kit (GE Healthcare Life Sciences, USA) according to Le Clec’h et al ...
-
bioRxiv - Microbiology 2021Quote: ... Membranes were developed using the ECL Prime kit (Cytiva, Marlborough, MA) and imaged using Amersham Imager 600 (GE Healthcare, Amersham, Buckinghamshire, UK). Fractionation was repeated with 3 independent sets of cultures and one set of immunoblots is presented as a representative.
-
bioRxiv - Microbiology 2020Quote: ... extracted DNA was subjected to multiple displacement amplification (MDA) using the illustra GenomiPhi V2 DNA amplification kit (GE Healthcare, Piscataway, NJ, USA), following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... total RNA from 30–50 light-treated or dark control embryos was extracted using the illustra™ RNAspin Mini kit (GE Healthcare). 1 μg total RNA was used for reverse transcription with qScript XLT cDNA SuperMix (Quantabio) ...
-
bioRxiv - Immunology 2021Quote: ... 10μg/mL of C-terminal 6X-His tag containing recombinant SARS-CoV-2 Spike protein was captured at a flow rate of 10μL/minute for 180 seconds onto carboxymethylated (CM5) dextran sensor chips immobilised with anti-His mAb using EDC/NHS amine coupling kit (GE Healthcare, Australia). The sensor chips were equilibrated with running buffer [HEPES buffer (HBS-EP+ ...
-
bioRxiv - Genomics 2021Quote: Single-cell WGA was done on 10~17 μm or 17~25 μm C1 DNA-Seq IFC (Fluidigm, 100-5763 or 100-5764) via multiple displacement amplification method using illustra GenomiPhi V2 DNA Amplification Kit (GE Healthcare, 25660031). The WGA products from single cells were mixed according to their tissue origin ...
-
bioRxiv - Molecular Biology 2022Quote: ... The probes (PCR amplified from gDNA or binary plasmid using the oligos in Supplemental Table S3) were internally labelled using [α-P32] dCTP (BRIT India) using Rediprime labelling kit (GE healthcare) and hybridisation and washes were performed as described ...
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were washed thrice with PBST and the bands corresponding to protein of interest were detected by chemiluminescence using the Amersham ECL Prime Western Blotting Detection Kit (GE Healthcare; RPN2232) in a Fusion FX7 Spectra Multispectral Imaging system (Witec AG ...
-
bioRxiv - Microbiology 2022Quote: ... whole genome amplification was carried out using the multiple displacement amplification technique with the Genomiphi V2 DNA Amplification Kit (GE Healthcare, USA). This approach has been widely used previously in various works [18–20] ...
-
bioRxiv - Microbiology 2023Quote: ... All genes used in the curves were purified with the IllustraTM GFXTM PCR DNA and Gel Band Purification Kit (GE Healthcare, UK) for better efficiency of the standard curves ...
-
bioRxiv - Pathology 2023Quote: The circular DNA genomes of MSV were first amplified by rolling circle amplification (RCA) according to the manufacturer’s protocol (TempliPhiTM kit, GE Healthcare, Munich, Germany). Then ...
-
bioRxiv - Microbiology 2023Quote: ... Anti-rabbit immunoglobulin AP-conjugated secondary antibody was used and reaction results were obtained using CDP Start Detection Reagent kits (GE Healthcare, USA) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein bands were visualized using an ECL kit (Ez WestLumi plus, ATTO, Tokyo, Japan) via chemiluminescence (ImageQuant LAS 4000 mini, GE Healthcare, USA) and quantified using NIH ImageJ software (National Institutes of Health ...
-
bioRxiv - Neuroscience 2024Quote: ... the membranes were further washed 3x with TBST and once with TBS before visualization of the resulting bands with ECL Advanced Western Blotting Detection Kit (GE Healthcare, #RPN2135) in an Amersham Imager 600 (GE Healthcare) ...
-
bioRxiv - Cell Biology 2020Quote: ... The purifications of these proteins from transformed bacterial cell extract were performed according to manufacturer instructions (GST bulk kit, GE Healthcare Life Sciences). The purified soluble GST proteins were immobilized on glutathione sepharose 4B beads (GE Healthcare Life Sciences) ...
-
bioRxiv - Cell Biology 2020Quote: ... The two fragments were fused by PCR to obtain a product corresponding to the 783 bp coding sequence of TMEM70 transcript variant 1 that was cloned into pMOSblue vector using the Blunt-Ended PCR Cloning Kit (GE Healthcare Life Sciences) to generate the pMOS-TMEM70 plasmid ...
-
bioRxiv - Physiology 2020Quote: Distinct bands of correct size were cut from 1.5% agarose gel and isolated using illustra GFX PCR and Gel Band Purification Kit (GE Healthcare, Chicago, IL, USA), following manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2019Quote: Samples each containing 2 μg Chl a of ΔpsbO-PSII-M and ΔpsbO-NRC were precipitated using the 2D Cleanup Kit (GE Healthcare, Chicago, IL) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... PCR reactions were analyzed by agarose gel electrophoresis with ethidium bromide staining and purified using the Illustra GFX PCR DNA and Gel Band Purification kit (GE Healthcare, Chicago, IL). Reactions (10 μL ...
-
bioRxiv - Cell Biology 2021Quote: ... or anti-Scp160 antibodies (Gift of R. Jansen, U. Tuebingen) was performed using the Amersham ECL Western Blotting Detection Kit (GE Healthcare Life Sciences). Quantification of protein bands was performed using ImageJ software.
-
bioRxiv - Synthetic Biology 2022Quote: CM3 sensor chips were coupled with streptavidin to near saturation (typically between 4000 and 7000 RU) using the amine coupling kit (GE Healthcare Life Sciences). After streptavidin was coupled ...
-
bioRxiv - Immunology 2020Quote: CM5 sensor chips were coupled with streptavidin to near saturation (typically between 4000 and 7000 RU) using the amine coupling kit (GE Healthcare Life Sciences). After streptavidin was coupled ...