Labshake search
Citations for GE Life Sciences :
1 - 50 of 415 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... was amplified by PCR using the primers (5’-GGTTCCGCGTGGATCCATGTCTCATGCAGCCGAGCCA-3’ and 5’-GGAATTCCGGGGATCCTCAGGACTCCTCTTCAATGCTGA-3’) and cloned into BamHI site of pGEX-4T-1 expression vector (GE Healthcare) using In-Fusion HD Cloning System (Clontech) ...
-
bioRxiv - Biochemistry 2023Quote: ... The SIRT6-145 base pair / SIRT6-172 base pair nucleosome samples were first purified using a Superdex 200 column (GE Healthcare) and then stabilized using the GraFix method (37) ...
-
bioRxiv - Cell Biology 2020Quote: ... beta-Pix/ArghGEF7 (J-009616-07, Dharmacon GE Healthcare) or untargetting control were used ...
-
bioRxiv - Molecular Biology 2020Quote: ... and RNA primer 5’-rCrArGrUrGrCrUrArUrGrUr GrArGrArUrUrArArGrUrUrArU-3’ were prepared by solid phase synthesis on an ÄKTA oligopilot plus 10 (GE Healthcare). RNAs were cleaved from the solid support by treating with 4 mL of a 1:1 mixture of 28% wt NH3/H2O solution and 33% wt CH3NH2/EtOH solution at 55°C for 30 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... albicans Phr1 and Pga4 gene without the sequence encoding signal peptide and the GPI anchor were constructed using primers listed in Supplementary Table 3 and cloned into the bacterial expression vector pGEX6P1 (GE healthcare, Stockholm, Sweden). Plasmids were then transformed into E ...
-
bioRxiv - Cell Biology 2022Quote: ... pairs of newly formed daughter cells were imaged on a DeltaVision Ultra (GE Healthcare) microscope system ...
-
bioRxiv - Neuroscience 2022Quote: ... Truncated mouse RANKL transcript (encoding amino acids 137-316 of mouse RANKL) was PCR amplified (forward primer: CACCCCCGGGCAGCGCTTCTCAGGAGCT, reversed primer: GAGACTCGAGTCAGTCTA TGTCCTGAAC) and then cloned into pGEX-5X-2 vector (GE Healthcare) between SmaI and XhoI sites ...
-
bioRxiv - Neuroscience 2020Quote: ... a PCR product of the intracellular domain flanked by BamHI and XhoI restriction sites was created from the equivalent full-length construct (forward primer catcatggatcctacaagcgggaccggcgcc; reverse primer catcatctcgagctatacccgagtggtggagtg) and subcloned into pGEX4T3 (GE Healthcare). GFP-tagged Gephyrin-FingR was a gift from Don Arnold (Addgene plasmid #46296 (Gross et al. ...
-
bioRxiv - Molecular Biology 2024Quote: ... Equilibrium dissociation constants (KD) of each pair of PLpro-ligand interaction were calculated using Biacore Evaluation Software (GE Healthcare) by fitting to a 1:1 Langmuir binding model.
-
bioRxiv - Biochemistry 2022Quote: ... Elution was performed on an Äkta primer (GE Healthcare) using a gradient from 0-100% Ni-elution buffer (50mM Tris pH 7.5 ...
-
bioRxiv - Cell Biology 2020Quote: ... membranes were developed using ECL primer solution (GE healthcare RPN2236). The primary antibodies used in this study are the followings ...
-
bioRxiv - Cell Biology 2023Quote: ... Chemiluminescence detection was achieved using ECL Primer reagents (GE Healthcare, UK).
-
bioRxiv - Cancer Biology 2020Quote: ... the membranes were incubated with 10,000-fold diluted peroxidase-linked secondary antibody (NA931V for FLAG-BRCA2 and NA934V for beta-Actin; GE Healthcare) at room temperature for 4 hours ...
-
bioRxiv - Biochemistry 2022Quote: ... and eluted by gradient introduction of high-salt buffer (50mM Tris pH7.0, 1M NaCl, 2mM MgCl2, 1mM ATP, 2mM beta-mercaptoethanol) on an ÅKTA system (GE Healthcare). Protein-containing pooled fractions from IEX were then loaded onto a Superdex 200 Increase 10/300 GL gel filtration column (GE Healthcare ...
-
bioRxiv - Cell Biology 2020Quote: Human ileal enteroids were transduced with GIPZ lentiviral shRNA kit for human Coronin 1a (GE Healthcare Dharmacon) based on protocol adapted from Heijmans et al.17 ...
-
bioRxiv - Bioengineering 2021Quote: ... Human peripheral blood mononuclear cells (PBMCs) were isolated from fresh human peripheral blood using Ficoll (GE Healthcare) density gradient centrifugation ...
-
bioRxiv - Cancer Biology 2021Quote: ... pH 3-10 (GE Healthcare) and peptides focused for 20 kVh ...
-
bioRxiv - Cancer Biology 2021Quote: ... pH 3-10 (GE Healthcare) diluted 1:50 in 5% glycerol ...
-
bioRxiv - Immunology 2020Quote: ... Human peripheral blood mononuclear cells (PBMC) were separated from healthy human blood samples using Ficoll-Paque (GE healthcare) or Lymphoprep (Stem Cell ...
-
bioRxiv - Cancer Biology 2023Quote: ... human ERBB4 siRNA pool and human ERBB2 siRNA pool were purchased (Dharmacon GE Healthcare, now Horizon Discovery Ltd.). miRNA mimics ...
-
bioRxiv - Cancer Biology 2020Quote: ... 100nM Human DDX5 siRNA pool (GE Healthcare Dharmacon ...
-
bioRxiv - Cell Biology 2021Quote: cDNA encoding human Nup35 was amplified from MGC Human Nup35 sequence-verified cDNA (Accession number BC047029, GE Healthcare, Dharmacon), using primers that add an amino terminal HA tag ...
-
bioRxiv - Microbiology 2021Quote: ... or pGEX-6P-3 (GE Healthcare). Pc3566 (from the −35 box to the TSS ...
-
bioRxiv - Microbiology 2023Quote: ... 1.04% PharmalyteTM 3 – 10 (GE Healthcare), 50 mM DTT and trace amounts of bromophenol blue) ...
-
bioRxiv - Neuroscience 2020Quote: ... primer-dimers and small fragments were removed by 0.5 U Exonuclease (GE Healthcare, E70073Z) treatment for 1 h at 42 °C ...
-
bioRxiv - Microbiology 2020Quote: ... a CM5 sensor chip was immobilized with a mouse anti-human IgG CH2 mAb using reagents and instructions supplied with the Human Antibody Capture Kit (GE Healthcare) in order to capture RBD-Fc or ACE2-Fc ...
-
bioRxiv - Biochemistry 2022Quote: ... The antibodies were captured on a CM5 chip immobilized with anti-human IgG Fc using a Human Antibody Capture Kit (GE Healthcare), according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... pH 3–10 (GE Healthcare Life Sciences), and bromophenol blue were added and centrifuged (14,000 rpm for 10 min ...
-
bioRxiv - Immunology 2022Quote: ... 3 ml Ficoll-Paque media (GE Healthcare) was pipetted into the bottom and the diluted 4 ml blood sample was carefully layered on top ...
-
bioRxiv - Molecular Biology 2022Quote: ... Human cDNA of JAZF1 was purchased from GE Healthcare. Open reading frame (ORF ...
-
bioRxiv - Immunology 2021Quote: ... Human antibodies purified by Protein-G (GE Healthcare, USA) affinity chromatography were stored at -80°C until use.
-
bioRxiv - Immunology 2021Quote: Human PBMCs were separated on Ficoll-Paque (GE Healthcare) by density centrifugation of heparinized blood from healthy donors (“Etablissement Français du Sang” EFS ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... CG42797EcoRI_F: 5’-CCGgaattcATGGAGCCACCAGCT-3’ and CG42797XhoI_R: 5’-TAGAGGTACCctcgagCTACTCAATGCCGAACGTGTTG-3’ and cloned by enzymatic digestion into a pGEX6P1(GE Healthcare).
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... CG42797EcoRI WWI_F: 5’-ccgGAATTCCCACCATTGCCGCCTG-3’ CG42797XhoI WWII_R: 5’-ccgCTCGAGTCAACGAGGATCCATGAA-3’ and cloned by enzymatic digestion into a pGEX6P1(GE Healthcare).
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... CG42797EcoRI_F: 5’-CCGgaattcATGGAGCCACCAGCT-3’ and CG42797XhoI_Nterm_R: 5’-CCGctcgagTCATTCGCTGGGCTGC-3’ and cloned by enzymatic digestion into a pGEX6P1(GE Healthcare).
-
bioRxiv - Cancer Biology 2022Quote: Human peripheral blood mononuclear cells (PBMC) were purified from human blood buffy coat using Ficoll Paque Plus (GE Healthcare, cat. 17-1440-02) reagent and CD14+ microbeads (MACS Miltenyi Biotec ...
-
bioRxiv - Biochemistry 2022Quote: ... and then immobilized in 7 cm IPG strips (pH 3-10 : 70×3×0.5 mm) and a linear gradient (NL) (GE Healthcare Immobiline™ Dry Strip IPG ...
-
bioRxiv - Immunology 2023Quote: ... [3] A HisTrap FF column (Cytiva, GE Healthcare) was used in the Äkta Pure protein chromatography system (GE Healthcare) ...
-
bioRxiv - Cell Biology 2020Quote: ... Human RAB34 cDNA was obtained from GE Healthcare (MHS6278-202807876) and cloned into Gateway pENTR plasmid pDONR221 (Invitrogen) ...
-
bioRxiv - Immunology 2021Quote: Human PBMCs were isolated by Ficoll-Paque PLUS (GE Healthcare) density gradient centrifugation ...
-
bioRxiv - Immunology 2020Quote: ... human C5b was immobilised on a CM5 chip (GE Healthcare). Flow cells were activated using a standard immobilisation protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... and the cleaved DRH-3 CTD and DRH-3 NTD were purified using a Superdex 75 HiLoad 16/600 size-exclusion column (GE Healthcare). Peak fractions were pooled and concentrated to 5-15 mg ml−1 in a buffer containing 20 mM HEPES pH 7.5 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The sample was then run on an 18 cm 3-10 strip using the Ettan IPGphor 3 Isoelectric Focusing System (GE Healthcare). Four voltage steps (50 V for 10 hours ...
-
bioRxiv - Cancer Biology 2022Quote: Custom siRNAs targeting 5’-CACCAUGAGUGGCAGUCAG-3’ 33 for FRA1 and 5′-GUUCACUGCUGGCCUAUAA-3’ 34 for FLI1 were ordered from GE Healthcare Dharmacon ...
-
bioRxiv - Biochemistry 2021Quote: ... PKAc was immobilized via standard N-hydroxysuccinimide (NHS) / 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) amine coupling on a CM5 (carboxyl methyl dextran) sensor chip (GE Healthcare). Before covalent immobilization of PKAc ...
-
bioRxiv - Microbiology 2021Quote: ... using a mixed solution of 200 mM 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) and 50 mM N-hydroxysuccinimide (NHS) in a Biacore T-200 SPR instrument (GE Healthcare), reaching 1000 response units (RU) ...
-
bioRxiv - Neuroscience 2023Quote: ... the lysates were adjusted to equal protein concentrations and incubated with 500 pmol of GST-14-3-3 immobilised on glutathione-sepharose 4B beads (GE Healthcare) for 60 min at 4°C ...
-
bioRxiv - Neuroscience 2024Quote: The affinities of TfR-binding molecules for recombinant human human TfRapical were determined by SPR using a Biacore™ 8K instrument in 1X HBS-EP+ running buffer (GE Healthcare Life Sciences, BR100826). Molecules were immobilized on a Series S CM5 chip (Cytiva ...
-
bioRxiv - Molecular Biology 2024Quote: Dried blood spot (DBS) samples were collected on Whatman 3-mm filter paper (Whatmann No. 3, GE Healthcare Life Sciences, PA, USA) from enrolled patients on Day 0 (before treatment ...
-
bioRxiv - Molecular Biology 2020Quote: ... and subcloned into the pGEX-6P-3 (GE Healthcare).