Labshake search
Citations for GE Life Sciences :
601 - 650 of 5464 citations for Human Single stranded DNA binding protein 4 SSBP4 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... phenolics and nucleic acids in extracted protein were removed using the 2-D Clean-Up kit (GE Healthcare, Piscataway, NJ, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... The plate and column pools were amplified using the Illustra GenomiPhi HY DNA Amplification Kit (GE Healthcare Life Sciences, UK) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Digestion products were purified with the illustra GFX PCR DNA and gel band purification kit (GE Healthcare, Little Chalfont, UK) and were directionally cloned in the yeast expression vector pYES2 (Invitrogen ...
-
bioRxiv - Microbiology 2019Quote: ... The Illustra Ready-To-Go GenomiPhi V3 DNA Amplification Kit (Cat. No. 25-6601-96, GE Healthcare Life Sciences, UK) was used for viral genome amplification (expected avg ...
-
bioRxiv - Genetics 2019Quote: ... PCR amplicons from each species presenting positive signals for Micropia were separated by 1.5% agarose gel electrophoresis and purified using Illustra GFXTM PCR DNA and Gel Band Purification kit (GE Healthcare) according to the supplier’s specifications ...
-
bioRxiv - Microbiology 2019Quote: ... PCR products were visualized on agarose gel then purified using PCR DNA and Gel Band Purification kit (GE Healthcare, UK).
-
bioRxiv - Microbiology 2023Quote: ... The positive DNA control was produced by random amplification of 2.5 µl DNA from the BAL of patient LA2 using the GenomiPhi HY kit (GE Healthcare), followed by a purification step using the columns of the QIAamp DNA Blood Mini Kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2022Quote: Human peripheral blood mononuclear cells (PBMC) were purified from human blood buffy coat using Ficoll Paque Plus (GE Healthcare, cat. 17-1440-02) reagent and CD14+ microbeads (MACS Miltenyi Biotec ...
-
bioRxiv - Biochemistry 2023Quote: ... Glutathione-sepharose 4 beads (GE Healthcare) were added to remove the cleaved tags and non-cleaved protein for another 2 h at 4°C in a column under gravity flow ...
-
bioRxiv - Cell Biology 2022Quote: The real time protein-protein interaction of protease and PDZ domain proteins of PfHtrA2was analysed by SPR using Biacore T200 instrument (GE Healthcare, Uppsala, Sweden) as described previously [7] ...
-
bioRxiv - Developmental Biology 2021Quote: ... Extracted proteins were immunoprecipitated with Protein A Sepharose CL-4B beads (GE Healthcare, USA) and desired primary antibodies ...
-
bioRxiv - Cell Biology 2021Quote: Protein purification was carried out with the AKTA-prime protein purification system (GE Healthcare). First ...
-
bioRxiv - Biochemistry 2020Quote: ... Proteins were purified from supernatants by protein A affinity chromatography using ÄKTA (GE Healthcare) or NGC (Bio-Rad ...
-
bioRxiv - Microbiology 2020Quote: ... S1 -Fc proteins were purified using Protein A-Sepharose beads (GE Healthcare Life sciences) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The protein-antibody complexes were captured with protein-G coupled Sepharose beads (GE Healthcare) by incubation at 4 °C for 1 h ...
-
bioRxiv - Microbiology 2020Quote: ... Fc-tagged ACE2 protein was then purified with a Protein A column (GE Healthcare) followed by size exclusion chromatography.
-
bioRxiv - Molecular Biology 2020Quote: ... coupled to protein G- and/or protein A-sepharose beads (GE Healthcare UK Ltd.). Proteins were eluted from beads with 0.2M glycine HCl pH2.5 ...
-
bioRxiv - Microbiology 2020Quote: ... Fc-tagged ACE2 protein was then purified with a Protein A column (GE Healthcare) followed by size exclusion chromatography.
-
bioRxiv - Plant Biology 2023Quote: ... We purified recombinant proteins and MBP protein by a Hisprep IMAC column (GE Healthcare). Cis-fragments of target gene promoters (34-bp free probes of OsRFL containing the NRE motif and 23-bp free probes of OsMOC1 containing the WNNN (CCANTG ...
-
bioRxiv - Bioengineering 2023Quote: ... All fusion proteins were purified by using a protein A affinity column (GE Healthcare) and analyzed on SDS-PAGE in the reducing condition.
-
bioRxiv - Immunology 2023Quote: ... Fc-tagged ACE2 protein was then purified with a Protein A column (GE Healthcare) followed by size exclusion chromatography.
-
bioRxiv - Molecular Biology 2019Quote: ... Protein G beads (GE Healthcare) were washed thrice with 10 bed volumes BBN buffer ...
-
bioRxiv - Cell Biology 2019Quote: ... protein G-sepharose (GE Healthcare) (30 µl resin per 1 ml extract ...
-
bioRxiv - Cell Biology 2020Quote: ... protein A Sepharose (GE healthcare) bead pre-equilibrated with IP dilution buffer was added and nutated further for 2 hr at 4°C for immunoprecipitation ...
-
bioRxiv - Cell Biology 2020Quote: ... protein A-sepharose (GE Healthcare) beads were added to the cell lysate-antibody mixture and incubated at 4°C for 2 hours ...
-
bioRxiv - Microbiology 2021Quote: ... Protein G Sepharose (GE Healthcare) was used for purification of CSP antibody.
-
bioRxiv - Immunology 2021Quote: ... or protein A (GE Healthcare) (for IgG ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein G Sepharose (GE Healthcare) was added and incubated at 4C for 1 hr ...
-
bioRxiv - Plant Biology 2021Quote: The binding kinetics and affinities of MIK2ECD with SCOOP12 or SCOOP12SS/AA peptides were assessed on a Biacore T200 instrument (GE Healthcare, Pittsburgh, PA) with CM5 sensor chips ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... for analyzing the binding of a synthetic GRP78-targeting peptide WDLAWMFRLPVG (GL Biochem Ltd, Shanghai, China) in Biacore X100 SPR system (GE Healthcare, NJ, USA). The system was firstly equilibrated with the running buffer (10 mM HEPES ...
-
Mechanical forces impair antigen discrimination by reducing differences in T cell receptor off-ratesbioRxiv - Immunology 2022Quote: Binding properties of OT-I TCR interaction with OVA were measured by SPR on a Biacore S200 and T200 (GE Healthcare Life Sciences) using a CM5 sensor chip and by GCI on the WAVEsystem (Creoptix ...
-
bioRxiv - Cell Biology 2020Quote: Binding of Wbox2 to SNX9 and AP2-β2-hinge+appendage domain was investigated by ITC using a MicroCal iTC200 (GE Healthcare Life Sciences). Measurements were performed in 20mM HEPES ...
-
bioRxiv - Molecular Biology 2019Quote: ... characterization of an N-terminal Aβ peptide DAE-EG (DAEFRHDSGYSGKQKSRNEGKGGC) binding to anti-mouse captured antibodies from hybridoma supernatants was performed using a BIAcore T-200 instrument (GE Healthcare, Marlborough, MA) [36] ...
-
bioRxiv - Microbiology 2020Quote: Binding kinetics and affinities for ACE2.Fc were assessed using surface plasmon resonance technology on a Biacore T200 instrument (GE Healthcare, Marlborough, MA) using a Series S CM5 sensor chip in filtered and degassed HBS-EP running buffer (10 mM HEPES ...
-
bioRxiv - Synthetic Biology 2021Quote: ... that had been pre-equilibrated with 10 column volumes of binding buffer (1x PBS, 5mM DTT) using a AKTA FPLC (GE Healthcare, Piscataway, NJ). The column was washed with 10 column volumes of binding buffer and protein was eluted in 100% elution buffer (50 mM Tris ...
-
bioRxiv - Biochemistry 2021Quote: ... of L-enantiomeric peptides CDP1 and CDP7 binding to SARS-CoV-2 3CLpro was determined by Surface Plasmon Resonance Spectroscopy (SPR) using a Biacore 8K instrument (GE Healthcare, Uppsala, Sweden). The peptides were immobilised on two separate channels on a series S CM-5 sensor chip (Cytiva ...
-
bioRxiv - Cell Biology 2020Quote: ... Human RAB34 cDNA was obtained from GE Healthcare (MHS6278-202807876) and cloned into Gateway pENTR plasmid pDONR221 (Invitrogen) ...
-
bioRxiv - Immunology 2021Quote: Human PBMCs were isolated by Ficoll-Paque PLUS (GE Healthcare) density gradient centrifugation ...
-
bioRxiv - Immunology 2020Quote: ... human C5b was immobilised on a CM5 chip (GE Healthcare). Flow cells were activated using a standard immobilisation protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were washed thrice with PBST and the bands corresponding to protein of interest were detected by chemiluminescence using the Amersham ECL Prime Western Blotting Detection Kit (GE Healthcare; RPN2232) in a Fusion FX7 Spectra Multispectral Imaging system (Witec AG ...
-
bioRxiv - Plant Biology 2020Quote: ... The solution was neutralized by adding 1 M HCl and the cDNA was purified with the illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare). The 5’-3’ junction sequence was amplified by PCR with cox1 specific primers Atcox1-5’(−176..-196 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR products were cleaned with an Illustra GFX PCR DNA and gel band purification kit (GE Healthcare, Chicago, IL, USA) and sequenced by using Sanger technology in an ABI 3730XL sequencer (STAB-VIDA ...
-
bioRxiv - Microbiology 2021Quote: Genomic DNA was extracted from 1 ml overnight bacterial culture using the Illustra bacteria genomicPrep Mini Spin Kit (GE Healthcare, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: Recombinant pGEM-T easy vectors used to sequence the lncov1 full-length were digested with EcoRI (Fermentas) and purified again with the Illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare). In vitro reverse transcription was performed using the RiboMax T7 system (Promega ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... The PCR product was gel purified by Illustra GFX PCR DNA and Gel Band Purification Kits (GE Healthcare, Chicago, Illinois, USA), cloned into pJET 1.2/blunt vector (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2019Quote: ... rVACV-eGFP-OVA-Early and rVACV-eGFP-OVA-Late were generated by transfecting plasmid DNA into BSC-1 cells infected with VACV-vRB21 at an MOI of 1 using the CellPhect Transfection Kit (GE Healthcare). The resulting rVACVs were plaque-purified 3× prior to characterization ...
-
bioRxiv - Plant Biology 2022Quote: ... of leaf tissues from M15 plants grown outside under low light conditions using the illustra Nucleon Phytopure Genomic DNA Extraction Kit (GE Healthcare) after grinding the leaves in liquid nitrogen to a fine powder ...
-
bioRxiv - Cell Biology 2023Quote: Gel-purified PCR products were used to generate radio-labeled probes to detect CLN2 and ACT1 mRNAs by Northern blotting (oligonucleotides: TCAAGTTGGATGCAATTTGCAG, TGAACCAATGATCAATGATTACGT; ACT1 oligonucleotides: TCATACCTTCTACAACGA-ATTGAGA and ACACTTCATGATGGAGTTGTAAGT. Probes were labeled using the Megaprime DNA labelling kits (GE Healthcare). Northern blotting was carried out as previously described (Cross and Tinkelenberg ...
-
bioRxiv - Molecular Biology 2022Quote: The samples were purified using a minicolumns GFX PCR DNA & gel band purification kit (GE Healthcare Bio-Sciences AB Uppsala, Sweden) according to a previously described protocol (https://dx.doi.org/10.17504/protocols.io.brzpm75n) ...
-
bioRxiv - Molecular Biology 2022Quote: ... the PCR amplified eleven positive virus genomes were amplified by RCA (rolling circle amplification) using the RCA-based TempliPhi DNA amplification kit (GE Healthcare) following the manufacturer’s instructions ...