Labshake search
Citations for GE Life Sciences :
1 - 50 of 156 citations for Human PDGF alpha receptor PDGFRA qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Membranes were probed with primers 32P-labelled with [alpha-P32]Deoxycytidine 5’-triphosphate (dCTP) using Megaprime DNA labelling system (GE Healthcare) (for primers ...
-
bioRxiv - Genetics 2021Quote: SARS-CoV-2 receptor binding domain binding to human extracellular ACE2 were analysed on a Biacore T200 instrument (GE Healthcare Life Sciences) at 37°C and a flow rate of 30 μl/min ...
-
bioRxiv - Biochemistry 2023Quote: ... The SIRT6-145 base pair / SIRT6-172 base pair nucleosome samples were first purified using a Superdex 200 column (GE Healthcare) and then stabilized using the GraFix method (37) ...
-
bioRxiv - Physiology 2020Quote: ... Insulin Receptor siRNA was obtained by GE Healthcare Dharmacon ...
-
bioRxiv - Genetics 2024Quote: ... without Alpha-Thioglycerol (GE Healthcare Life Sciences Cat. # SH30228.01); 1X GlutaMAX-I ...
-
bioRxiv - Cell Biology 2022Quote: ... pairs of newly formed daughter cells were imaged on a DeltaVision Ultra (GE Healthcare) microscope system ...
-
Molecular basis of selective cytokine signaling inhibition by antibodies targeting a shared receptorbioRxiv - Immunology 2021Quote: ... pH 7.4 (cytokines using Superdex 75 and receptors using Superdex200, prep grade media, GE Healthcare). In addition ...
-
bioRxiv - Cell Biology 2020Quote: Receptor was further purified using anion-exchanged chromatography using HiTrap Q HP column (GE Healthcare). Protein was diluted 1:10 with buffer A (20 mM MOPS pH=7.0 ...
-
bioRxiv - Biophysics 2023Quote: ... The eluted receptor was desalted from imidazole using a size-exclusion PD10 column (GE Healthcare) equilibrated with the desalt buffer (25 mM HEPES pH=7.5 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Next the receptor was purified by size exclusion chromatography on a Sephadex S200 column (GE Healthcare) in 20 mM HEPES pH 8 ...
-
bioRxiv - Neuroscience 2022Quote: ... Truncated mouse RANKL transcript (encoding amino acids 137-316 of mouse RANKL) was PCR amplified (forward primer: CACCCCCGGGCAGCGCTTCTCAGGAGCT, reversed primer: GAGACTCGAGTCAGTCTA TGTCCTGAAC) and then cloned into pGEX-5X-2 vector (GE Healthcare) between SmaI and XhoI sites ...
-
bioRxiv - Neuroscience 2020Quote: ... a PCR product of the intracellular domain flanked by BamHI and XhoI restriction sites was created from the equivalent full-length construct (forward primer catcatggatcctacaagcgggaccggcgcc; reverse primer catcatctcgagctatacccgagtggtggagtg) and subcloned into pGEX4T3 (GE Healthcare). GFP-tagged Gephyrin-FingR was a gift from Don Arnold (Addgene plasmid #46296 (Gross et al. ...
-
bioRxiv - Biophysics 2022Quote: ... The cleaved receptor solution was then loaded onto a 5 mL HiTrap SP HP column (GE Healthcare) using an Akta Start system (GE Healthcare ...
-
bioRxiv - Cell Biology 2021Quote: ... and the phosphorylation levels of receptor tyrosine kinase were detected with the image analyzer 680 (GE Healthcare).
-
bioRxiv - Biochemistry 2022Quote: ... The cleaved receptor solution was then loaded onto a 5 mL HiTrap SP HP column (GE Healthcare) using an Akta Start system (GE Healthcare ...
-
bioRxiv - Molecular Biology 2024Quote: ... Equilibrium dissociation constants (KD) of each pair of PLpro-ligand interaction were calculated using Biacore Evaluation Software (GE Healthcare) by fitting to a 1:1 Langmuir binding model.
-
bioRxiv - Biochemistry 2022Quote: ... Elution was performed on an Äkta primer (GE Healthcare) using a gradient from 0-100% Ni-elution buffer (50mM Tris pH 7.5 ...
-
bioRxiv - Immunology 2024Quote: Affinity of bNAbs for Fcγ Receptors was assessed by SPR experiments performed on a Biacore T200 (GE Healthcare). SPR experiments were performed on a T200 apparatus at 25°C in PBS containing 0,05 % P20 surfactant (Cytiva) ...
-
bioRxiv - Cell Biology 2020Quote: ... membranes were developed using ECL primer solution (GE healthcare RPN2236). The primary antibodies used in this study are the followings ...
-
bioRxiv - Biochemistry 2022Quote: ... Fc-fusion constructs of each receptor were captured using either a Series S Protein A sensor chip (GE Healthcare) or a Series S CM5 sensor chip (GE Healthcare ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cleaved receptor was separated from eGFP by SEC on a Superdex 200 10/300 GL column (GE Healthcare) pre-equilibrated with m7-glycerol+ buffer containing 6.7 mM DMCH ...
-
bioRxiv - Cell Biology 2023Quote: ... Chemiluminescence detection was achieved using ECL Primer reagents (GE Healthcare, UK).
-
Intra-mitochondrial proteostasis is directly coupled to alpha-synuclein and Amyloid β 1-42 pathologybioRxiv - Neuroscience 2020Quote: ... Alpha-synuclein was then further purified on a HiPrep Phenyl FF 16/10 (High Sub) hydrophobic interaction column (GE Healthcare) (76) ...
-
bioRxiv - Biochemistry 2021Quote: A mixture of 0.5 μM GST or GST tagged cargo receptors and different ATG proteins was incubated with 10 μL Glutathione Sepharose beads (GE Healthcare) in a reaction buffer containing 20 mM HEPES at pH 8.0 ...
-
bioRxiv - Biochemistry 2022Quote: ... Elution fractions containing receptor were pooled and subjected to polishing by SEC on a Superdex 200 Increase 10/300 GL column (GE Healthcare) in 20 mM HEPES ...
-
bioRxiv - Microbiology 2020Quote: 80 μg of primary epithelial cell lysates or 1 μg purified receptor candidates separated in SDS-PAGE gels were Western-blotted onto nitrocellulose (Amersham, GE Healthcare) with Schaeffer-Nielsen buffer (48mM Tris ...
-
bioRxiv - Immunology 2022Quote: ... assay was performed to quantify the binding avidity of the recombinant mos-tri-RBD to the receptor hACE2 using BIAcore 8K (GE Healthcare) with NTA chips ...
-
bioRxiv - Immunology 2022Quote: ... The ACE2 receptor or SARS-CoV-2 spike-specific antibodies (CR3022 or S309) were immobilized on the protein A sensor chip (GE Healthcare) at a ligand capture level of ∼100 RU ...
-
bioRxiv - Cell Biology 2020Quote: Human ileal enteroids were transduced with GIPZ lentiviral shRNA kit for human Coronin 1a (GE Healthcare Dharmacon) based on protocol adapted from Heijmans et al.17 ...
-
bioRxiv - Bioengineering 2021Quote: ... Human peripheral blood mononuclear cells (PBMCs) were isolated from fresh human peripheral blood using Ficoll (GE Healthcare) density gradient centrifugation ...
-
bioRxiv - Immunology 2020Quote: ... Human peripheral blood mononuclear cells (PBMC) were separated from healthy human blood samples using Ficoll-Paque (GE healthcare) or Lymphoprep (Stem Cell ...
-
bioRxiv - Cancer Biology 2023Quote: ... human ERBB4 siRNA pool and human ERBB2 siRNA pool were purchased (Dharmacon GE Healthcare, now Horizon Discovery Ltd.). miRNA mimics ...
-
bioRxiv - Cancer Biology 2020Quote: ... 100nM Human DDX5 siRNA pool (GE Healthcare Dharmacon ...
-
bioRxiv - Cell Biology 2021Quote: cDNA encoding human Nup35 was amplified from MGC Human Nup35 sequence-verified cDNA (Accession number BC047029, GE Healthcare, Dharmacon), using primers that add an amino terminal HA tag ...
-
bioRxiv - Neuroscience 2020Quote: ... primer-dimers and small fragments were removed by 0.5 U Exonuclease (GE Healthcare, E70073Z) treatment for 1 h at 42 °C ...
-
bioRxiv - Microbiology 2020Quote: ... a CM5 sensor chip was immobilized with a mouse anti-human IgG CH2 mAb using reagents and instructions supplied with the Human Antibody Capture Kit (GE Healthcare) in order to capture RBD-Fc or ACE2-Fc ...
-
bioRxiv - Biochemistry 2022Quote: ... The antibodies were captured on a CM5 chip immobilized with anti-human IgG Fc using a Human Antibody Capture Kit (GE Healthcare), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... Human cDNA of JAZF1 was purchased from GE Healthcare. Open reading frame (ORF ...
-
bioRxiv - Immunology 2021Quote: ... Human antibodies purified by Protein-G (GE Healthcare, USA) affinity chromatography were stored at -80°C until use.
-
bioRxiv - Immunology 2021Quote: Human PBMCs were separated on Ficoll-Paque (GE Healthcare) by density centrifugation of heparinized blood from healthy donors (“Etablissement Français du Sang” EFS ...
-
bioRxiv - Cell Biology 2020Quote: Plasma M- and Z-AAT was isolated by affinity chromatography using the AAT specific Alpha-1 Antitrypsin Select matrix (GE Healthcare Life Sciences, Cytiva, Sheffield, UK) according to the manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2022Quote: Human peripheral blood mononuclear cells (PBMC) were purified from human blood buffy coat using Ficoll Paque Plus (GE Healthcare, cat. 17-1440-02) reagent and CD14+ microbeads (MACS Miltenyi Biotec ...
-
bioRxiv - Cell Biology 2020Quote: ... Human RAB34 cDNA was obtained from GE Healthcare (MHS6278-202807876) and cloned into Gateway pENTR plasmid pDONR221 (Invitrogen) ...
-
bioRxiv - Immunology 2021Quote: Human PBMCs were isolated by Ficoll-Paque PLUS (GE Healthcare) density gradient centrifugation ...
-
bioRxiv - Immunology 2020Quote: ... human C5b was immobilised on a CM5 chip (GE Healthcare). Flow cells were activated using a standard immobilisation protocol ...
-
bioRxiv - Neuroscience 2024Quote: The affinities of TfR-binding molecules for recombinant human human TfRapical were determined by SPR using a Biacore™ 8K instrument in 1X HBS-EP+ running buffer (GE Healthcare Life Sciences, BR100826). Molecules were immobilized on a Series S CM5 chip (Cytiva ...
-
bioRxiv - Pathology 2020Quote: ... wt:wt) was determined by size exclusion chromatography in AKTA Primer Plus fast protein liquid chromatography system (GE Healthcare) with Superose™ 6 10/30 GL Column (GE Healthcare ...
-
bioRxiv - Developmental Biology 2020Quote: ... Flag primary antibody (monoclonal M2 mouse IgG1) and enhanced chemiluminescence assay (Amersham ECL Primer, GE Healthcare Life Science) were used for detection.
-
bioRxiv - Cell Biology 2022Quote: Human peripheral blood mononuclear cells were isolated by Ficoll (GE Healthcare) density gradient centrifugation and then stained with PE anti-CD3 (1:100 ...
-
bioRxiv - Microbiology 2021Quote: ... human or rabbit IgG (GE Healthcare Bio-Sciences Corp., Piscataway, NJ) were used and HRP activity detected using ECL plus (GE Healthcare Bio-Sciences Corp. ...