Labshake search
Citations for GE Life Sciences :
1 - 50 of 70 citations for GPR6 siRNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... siRNA and respective siRNA control were purchased from Dharmacon (GE Healthcare) and used at a final concentration of 25nM ...
-
bioRxiv - Cell Biology 2020Quote: NRVMs at a confluence of 50% were transfected with either control non-targeting siRNA or pooled siRNA targeting both AMPKα1 and AMPKα2 catalytic isoforms (AMPKα1/α2 siRNA) (from GE Healthcare 50nM) using lipofectamine RNAimax transfection reagent (Invitrogen ...
-
Epigenetic Interaction between UTX and DNMT1 Regulates Diet-Induced Myogenic Remodeling in Brown FatbioRxiv - Physiology 2020Quote: ... targeting siRNA and non-targeting scramble control siRNA were purchased from GE Healthcare (mouse Dnmt1 siRNA-SMARTpool (L-056796-01) ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNAs were from GE Life Sciences/Dharmacon ...
-
bioRxiv - Cell Biology 2020Quote: ... Following siRNAs from Dharmacon (GE Healthcare) were used for siRNA-mediated knock-down ...
-
bioRxiv - Cell Biology 2020Quote: ... using siRNA SMARTpool ON-TARGETplus Human UBTD1 (80019) or ON-TARGETplus Non-Targeting Control siRNAs) (GE Healthcare). Lipofectamine 2000 was used for plasmid transfection according to the manufacturer’s instructions (11668 ...
-
bioRxiv - Cancer Biology 2023Quote: ... human ERBB4 siRNA pool and human ERBB2 siRNA pool were purchased (Dharmacon GE Healthcare, now Horizon Discovery Ltd.). miRNA mimics ...
-
bioRxiv - Cancer Biology 2020Quote: ... 100nM Human DDX5 siRNA pool (GE Healthcare Dharmacon ...
-
bioRxiv - Cell Biology 2021Quote: ... and ON-TARGETplus nontargeting siRNA (GE Healthcare) was used as a negative control.
-
bioRxiv - Microbiology 2019Quote: ... siRNAs (ON-TARGETplus smartpool, Dharmacon, GE Healthcare) were diluted into PBS to a final concentration of 2 nM and mixed with 2 !l of RiboCellin siRNA Delivery Reagent (BioCellChallenge) ...
-
bioRxiv - Cell Biology 2020Quote: ... In a 48 well plate, 25-32.5μL siRNA (for sequences, see table 1) was mixed with 25uL 1x siRNA buffer (GE Healthcare) containing 0.5uL Dharmafect 1 transfection reagent ...
-
bioRxiv - Cancer Biology 2019Quote: STAT3 siRNA knockdown utilized the ON-TARGETplus Human STAT3 siRNA kit from GEHealthcare (L-003544-00-0005, GE Healthcare). This SMARTpool siRNA contains four pooled siRNAs ...
-
bioRxiv - Genetics 2019Quote: ... Pools of siRNA against human NOVA2 gene and of Scramble siRNA were purchased from Dharmacon (GE Healthcare, Lafayette, CO).
-
bioRxiv - Cell Biology 2020Quote: siRNA-mediated knockdown in 786-O cells was carried out using 5-10 nM Dharmacon ON-TARGETplus siRNAs (GE Healthcare), diluted in siRNA buffer and mixed with DharmaFECT transfection reagent (1:50 in optiMEM reduced serum media) ...
-
bioRxiv - Cell Biology 2022Quote: ... In a 24 well plate, 65μL siRNA [50nM] for sequences, see (Jongsma et al., 2016)) was mixed with 26uL 1x siRNA buffer (GE Healthcare) containing 1.15uL Dharmafect 1 transfection reagent ...
-
bioRxiv - Genomics 2019Quote: ... siRNAs for HDAC3 were purchased from GE Healthcare Dharmacon (Lafayette ...
-
bioRxiv - Physiology 2020Quote: ... Insulin Receptor siRNA was obtained by GE Healthcare Dharmacon ...
-
bioRxiv - Biochemistry 2021Quote: ... SEC61A1 siRNA (Sec61α-kd, GE Healthcare, sequence AACACUGAAAUGUCUACGUUUUU), MMGT1 siRNA (EMC5-kd ...
-
bioRxiv - Cell Biology 2021Quote: ... the siRNA D-023324-05 (GE Healthcare Dharmacon) and Stealth RNAis (#HSS126645 ...
-
bioRxiv - Immunology 2021Quote: ... All siRNAs were purchased from Dharmacon (GE Healthcare). Both BMDMϕ and hMϕ were incubated with the siRNA containing transfection complexes for 24h in RPMI medium and washed prior to transfection with LPS in Opti-MEM medium ...
-
bioRxiv - Cell Biology 2022Quote: ... siRNAs and shRNAwere purchased from Dharmacon (GE Healthcare) and transfections were performed using Dharmafect II for siRNAs and Lipofectamine 2000 for shRNAs ...
-
bioRxiv - Cancer Biology 2022Quote: ... siRNA non-targeting pool #2 (GE Healthcare Dharmacon) was used as a control for all the knockdown experiments ...
-
bioRxiv - Microbiology 2022Quote: ... siRNA (Catalog no. L-013607-00-0005) Human DHX9 (1660) siRNA (Catalog no. L-009950-00-0005) were from Ge Healthcare Dharmacon (Colorado ...
-
bioRxiv - Cell Biology 2021Quote: ... human ECs were transfected twice (at 0 and 24 h) with 200 pmol of siGENOME Non-Targeting siRNA #1 (as control) or siGENOME SMART pools siRNA oligonucleotides (GE Healthcare Dharmacon), using Oligofectamine Transfection Reagent (Thermo Fisher Scientific) ...
-
bioRxiv - Physiology 2019Quote: ... 20 islets per well (n = 3 biological replicates per group) were transfected with control (non-targeting #2) siRNA or mouse Brd4 SMARTpool siRNA (Dharmacon GE Life Sciences) at 100 nM each with lipofectamine 3000 according to the product instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... Kif2a (ON-TARGETplus, 3796, siRNA-SMARTpools; GE Healthcare, Switzerland) (Tan et al. ...
-
bioRxiv - Microbiology 2022Quote: Small interfering RNAs (siRNAs) were purchased from GE Healthcare Dharmacon (Lafayette ...
-
bioRxiv - Systems Biology 2020Quote: The siGENOME SMARTpool siRNAs were obtained from GE Healthcare (Dharmacon ...
-
bioRxiv - Cell Biology 2020Quote: ... SMART pool ON-TARGET plus siRNAs (Ambion/ GE Healthcare) were used ...
-
bioRxiv - Microbiology 2022Quote: ... HPV18 E6 siRNAs were purchased from Dharmacon (GE Healthcare) and had the following sequences ...
-
bioRxiv - Molecular Biology 2024Quote: ... siRNA transfections were performed using Dharmafect-1 (GE Healthcare) and 80nM of indicated siRNA ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were transfected with 20nM siRNA against hsa-CHST15_0003 or hsa-TNFRSF21_0001 or a non-targeting siRNA control (GE Healthcare Dharmacon, Inc., Lafayette, CO, USA) using Lipofectamine 3000 (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: HESCs were grown in a six-well culture plate to 60%–70% confluence and transfected with 60 pmol of non-targeting siRNA (D-001810-10-05) or siRNAs targeting ACE2 (L-005755-00-0005) (GE Healthcare Dharmacon Inc., Lafayette, CO) in Lipofectamine 2000 reagent (Invitrogen Corporation ...
-
bioRxiv - Microbiology 2023Quote: HeLa cells grown to 90% confluency were transfected with ON-TARGETplus human Skp1 SMARTpool siRNA or non-targeting siRNA (GE Healthcare Dharmacon, Inc., Lafayette, CO) at a final concentration appropriate to the vessel size ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were transfected with the indicated siRNAs using DharmaFECT (GE healthcare), HiPerFect (Qiagen ...
-
bioRxiv - Cell Biology 2020Quote: ... Control siRNA (negative) was obtained from GE Healthcare (D-001810-10).
-
bioRxiv - Cancer Biology 2020Quote: ... Constructs are siGENOME SMARTpool siRNAs (GE Healthcare Dharmacon, Lafayette, CO, USA) containing 4x siRNA targeting constructs ...
-
bioRxiv - Neuroscience 2023Quote: ... and Accell mouse Rbfox1 siRNA (A-041929-13, GE Healthcare Dharmacon). The efficacy of knockdown was validated in previous studies (19 ...
-
bioRxiv - Cancer Biology 2020Quote: ... or scramble siRNA pool (GE Healthcare Dharmacon, Catalog# D-001206-14-05) were mixed with Opti-MEM medium and Lipofectamine 3000 (L3000001 ...
-
bioRxiv - Cell Biology 2021Quote: ... a non-targeting scramble siRNA (#D-001210-01-05, GE Healthcare Dharmacon) was used in the experiments shown in figure 3 and supplementary figure 6C while a pool of four scrambled siRNAs (#D-001206-13-05 ...
-
bioRxiv - Microbiology 2019Quote: ... Arf1 and the control siGENOME nontargeting siRNA were purchased from GE Healthcare Dharmacon (Lafayette ...
-
bioRxiv - Cell Biology 2019Quote: ... All constructs are siGENOME SMARTpool siRNAs (GE Healthcare Dharmacon, Lafayette, CO, USA): Non-targeting pool #2 (D-001206-14-05) ...
-
bioRxiv - Cell Biology 2022Quote: ... Non-targeting siRNA ON-TARGETplus (D-001810-10-05) (Dharmacon, GE Healthcare) served as the siRNA control (“siRNA scramble”) ...
-
Cancer-associated fibroblasts produce matrix-bound vesicles that influence endothelial cell functionbioRxiv - Cancer Biology 2023Quote: ... or THY1 human siRNA (L-015337-00-0005, GE Healthcare Dharmacon, Inc.). CAFs were used for experiments 72h after transfection.
-
bioRxiv - Cell Biology 2021Quote: ... siRNAs were transfected with DharmaFECT transfection reagent (#T-2001-02, GE Healthcare Dharmacon) according to the instructions of the manufacturer ...
-
bioRxiv - Cell Biology 2022Quote: ... ON-TARGETplus Human TP53/PTGS1/PTGS2 siRNA SMARTpool by Dharmacon (GE Healthcare, Manchester, UK) was used ...
-
bioRxiv - Cell Biology 2020Quote: ... a set of ON-TARGET human siRNAs against Arp3 (J-012077-08, Dharmacon, GE Healthcare), Myh9 (J-007668-07 ...
-
bioRxiv - Microbiology 2020Quote: All siRNA duplexes used for in vitro studies were chemically synthesised by Dharmacon (GE Healthcare). The following siRNAs sense sequences were used ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNA specifically designed to target FL PANX1 (si-PANX1) was purchased from Dharmacon (GE Healthcare) (D-018253-02 ...
-
bioRxiv - Immunology 2020Quote: ... Transfection efficiency was determined using the fluorescently-labelled siGLO RISC-free control siRNA (GE Healthcare) and miRNA and/or mRNA expression was assessed afterwards.