Labshake search
Citations for GE Life Sciences :
701 - 750 of 886 citations for 7H Pyrrolo 2 3 b pyridine 3 7 dimethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: U-2 OS FUCCI cells were grown on a 96-well glass bottom plates (Whatman, Cat# 7716-2370, GE Healthcare, UK ...
-
bioRxiv - Immunology 2020Quote: ... 7.5×104 congenically distinct cells of each sorted memory population were adoptively transferred and tumor-bearing mice were subsequently immunized with 10 μg of GP33-41 and 2 μg of poly(I:C) (GE Healthcare) s.c ...
-
bioRxiv - Genetics 2019Quote: Germ cells and embryos were mounted on 2% agarose pads and imaged live using a DeltaVision Elite microscope (Applied Precision) with a 60x Silicon oil objective lens ...
-
bioRxiv - Genetics 2020Quote: ... 2-4 mg protein extract was added to 50 μl of Glutathione Sepharose beads (Cat. no. 17527901, GE healthcare Ltd.) equilibrated with 1XPBS and incubated for 10-14 hours at 4°C ...
-
bioRxiv - Biochemistry 2021Quote: All samples were prepared in a total volume of 40 μL in SEC buffer A supplemented with 2 mM DTT and analysed on a Superdex 75 3.2/300 Increase column (GE Healthcare). For the TTP-DCP2 interaction ...
-
bioRxiv - Immunology 2021Quote: ... the protein was diluted with 2-fold volume of 20 mM HEPES with pH 7.0 and loaded on HiTrap SP HP column (GE Healthcare) equilibrated with 100 mM NaCl ...
-
bioRxiv - Immunology 2021Quote: ... fragments or Fabs 2/1.12 or 2/6.14 were either used as analytes or amine immobilized on a CM5 chip in a Biacore 3000 (GE Healthcare) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: HEK293A cells were maintained in Dulbecco’s modified Eagle medium (DMEM) supplemented with 2 mM L-glutamine (GE Healthcare Life Sciences), 10% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2020Quote: ... Eluted protein was concentrated down to 2 mL for size exclusion chromatography with a Superose6 16/600 column (GE Healthcare) in 10 mM Tris pH8 ...
-
bioRxiv - Cell Biology 2022Quote: ... Time-lapse images (5-10 z-sections, 0.5–2 μm separation) were deconvolved using SoftWoRx software (Applied Precision, GE Healthcare) and processed with FIJI/ImageJ ...
-
bioRxiv - Cell Biology 2022Quote: Human isoform of amphiphysin 2/BIN1 including exon 11 was expressed in Rosetta 2 bacteria and purified by affinity chromatography using glutathione Sepharose 4B beads according to the manufacturer’s instructions (GE Healthcare) in 50 mM Tris at pH 8.0 ...
-
bioRxiv - Neuroscience 2022Quote: ... Images were taken at 2 second intervals for 1 minute and deconvoluted with Applied Precision softWorx imaging software (GE Healthcare). The microtubule comet tracking and quantification was performed with the MTrackJ plugin in ImageJ/Fiji (Meijering et al. ...
-
bioRxiv - Biophysics 2022Quote: ... the complex was further purified by anion exchange chromatography in presence of 2% CHAPS using the AKTA system (GE Healthcare), flash frozen and stored at −80 °C until use.
-
bioRxiv - Plant Biology 2023Quote: ... first-strand cDNA was synthesized from 2 µg of total RNA using Ready-to-Go RT-PCR beads (GE healthcare) and an oligo(dT ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... algae were grown for two weeks and harvested using a vacuum filtration with Whatman #2 paper (GE Healthcare 47 mm), washed with distilled water (three times) ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 µg of protein was immobilized on a nitrocellulose membrane (Amersham) by filtration using a slot blot apparatus (GE Healthcare). The membrane was blocked with 5% skimmed milk and probed with MJFR-14-6-4-2 (Abcam ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 mM NaCl.) supplemented with 2 mM CaCl2 and loaded onto a Superose6 Increase 10/300 GL column (GE Healthcare) integrated on a high-performance liquid chromatography (HPLC ...
-
bioRxiv - Microbiology 2023Quote: ... 200 mM NaCl and 2 mM TCEP using a Superdex-200 10/300 GL size-exclusion column from GE Healthcare. All protein concentrations were diluted to 1.7 mg/mL ...
-
bioRxiv - Molecular Biology 2023Quote: ... the combined peptide containing solutions were passed over pre-equilibrated (50 µl 0.5 % formic acid) home-made 2-disc Glass microfiber StageTip (disc material: GE Healthcare; pore size ...
-
bioRxiv - Bioengineering 2024Quote: Single-cycle kinetics analysis of CD4-Ig binding to the 16055-ConM-v8.1 SOSIP with C-terminal Spy-tag-2 (ST2) was performed at 25°C on a Biacore T100 (GE Healthcare). 1X HBS-EP containing 10 mM HEPES ...
-
bioRxiv - Plant Biology 2019Quote: ... and electrotransfered (2 h at 80 V or 16 h at 30 V and 4°C) onto polyvinylidene difluoride membrane (Amersham, GE Healthcare). The recombinant enzymes were probed using anti-V5-HRP conjugated antibody (Invitrogen) ...
-
bioRxiv - Biophysics 2021Quote: ... the sample was concentrated to 2 mL and loaded onto a HiPrep 16/60 Sephacryl S-300 HR column (GE Healthcare) equilibrated and run in Sizing Buffer (50 mM HEPES pH 7.5 ...
-
bioRxiv - Microbiology 2020Quote: ... The clarified cell lysates were incubated for 2 h on a spinning wheel at 4°C with 100µl of StrepTactin Sepharose High Performance beads (#28935599, GE Healthcare, USA). Beads were collected by centrifugation (1600 g for 5 min at 4°C ...
-
bioRxiv - Biochemistry 2020Quote: Proteins (200 μl at 2 μM) were separated on a Superdex 200 Increase 10/300 GL column (GE Healthcare Life Sciences) equilibrated in PBS ...
-
bioRxiv - Molecular Biology 2020Quote: ... Lysed cells were centrifuged 20,000 xg for 30 minutes at 4C and soluble lysate was filtered prior to IMAC purification using 2×5mL His-Trap columns (GE Healthcare) affixed to an Akta Pure ...
-
bioRxiv - Molecular Biology 2021Quote: ... The PAGE gel was exposed to a phosphosimage screen for ∼2 hours and analyzed using a Amersham Typhoon imaging system (GE Healthcare). Band intensities corresponding to the uncleaved ribozymes and the two products of self-scission were analyzed using ImageQuant (GE Healthcare ...
-
bioRxiv - Molecular Biology 2021Quote: ... Then the mixture was centrifuged for 2 mins and the supernatant was desalted by filtration with a Sephacryl S-400 HR column (GE Healthcare), centrifuged at 16 krpm ...
-
bioRxiv - Biochemistry 2019Quote: ... analytical gel size-exclusion chromatography was performed with 1-2 mg protein in buffer A on a Superdex 75 10/300 column (GE Healthcare), to which a static light-scattering (SLS ...
-
bioRxiv - Developmental Biology 2019Quote: ... A total of 96 fractions were collected in a row-wise snaking pattern into a Whatman 2 ml 96-well plate (GE Healthcare), which were then concatenated non-sequentially into a final 24 fractions for proteomic analysis ...
-
bioRxiv - Biochemistry 2019Quote: ... Protein was loaded at concentrations ranging from 2 to 16 mg/ml on a Superdex 200 10/300 GL column (GE Healthcare) equilibrated in 20 mM HEPES ...
-
bioRxiv - Biochemistry 2020Quote: ... and 2 mM DTT for 1 hour prior to purification on a Superdex 200 10/300 size-exclusion column (GE Healthcare). Rac1 (G12V ...
-
bioRxiv - Biochemistry 2019Quote: ... A 50-μl protein sample (1-2 mg/ml) was analyzed on a Superdex S-200 10/300 GL column (GE Healthcare) pre-equilibrated with a buffer containing 20 mM Tris-HCl (pH 8.0) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Stoichiometric amounts of each core histone were incubated together under high salt conditions (2 M NaCl) and the resulting histone octamer purified using a Superdex 200 gel filtration column (GE Healthcare). Purified 147bp DNA carrying the 601 nucleosome-positioning sequence was a kind gift from the Brockdorff lab ...
-
bioRxiv - Biochemistry 2019Quote: ... the purified sample was concentrated to 2 mL and loaded onto a HiPrep 16/60 Sephacryl S-300 HR column (GE Healthcare) equilibrated and run in Sizing Buffer (50 mM HEPES pH 7.5 ...
-
bioRxiv - Biophysics 2021Quote: ... After dialysis the histones in 2 M NaCl were concentrated to a volume of 1 mL and purified using an Superdex 200 column (GE Healthcare) on an FPLC (Agilent) ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins were concentrated to 2 mL and further purified by size-exclusion chromatography using HiLoad 16/600 Superdex 200 (Ge healthcare).
-
bioRxiv - Biochemistry 2021Quote: ... The purified protein was then concentrated to 2 mL and purified by FPLC sizeexclusion chromatography using a Superdex 75 10/300 GL (GE Healthcare) column into 20 mM NaPO4 150 mM NaCl pH 7.5 ...
-
bioRxiv - Bioengineering 2020Quote: ... The ligase was inactivated with 2 M NaCl and the sample was injected into a Sephacryl S-1000 size exclusion column (GE Healthcare) to remove excess oligos and DNA ligase.
-
bioRxiv - Bioengineering 2020Quote: Binding of SARS-CoV-2 RBD to ACE2 –Fc and ACE2mod–Fc fusion proteins were measured using a Biacore T200 instrument (GE Healthcare). Fusion proteins were first immobilized at a coupling density of ∽1000 response units (RU ...
-
bioRxiv - Biochemistry 2021Quote: 50 μl of the N protein samples (1 mg/ml) purified according to protocols 1 or 2 were loaded onto a Superdex 200 Increase 10/300 column (GE Healthcare) pre-equilibrated with 20 mM HEPES ...
-
bioRxiv - Neuroscience 2020Quote: ... 150 mM NaCl) containing 5% skim milk (Meiji) and subjected to primary antibody for 2 h and HRP-conjugated secondary antibody (GE Healthcare) for 30 min ...
-
bioRxiv - Biophysics 2021Quote: ... The flow through containing SARS-CoV-2 Mpro was collected and further purified using size exclusion chromatography column (G-100, GE Healthcare,) equilibrated with 20 mM Tris ...
-
bioRxiv - Cell Biology 2021Quote: ... myogenic differentiation was induced by replacing the medium with differentiation medium (DM) consisting of DMEM supplemented with 2% horse serum (GE Healthcare) and PS ...
-
bioRxiv - Biochemistry 2020Quote: ... The cleaved protein was separated from any His6-tagged species by passage through the Ni+2-NTA HisTrap HP column and purified further using size-exclusion chromatography (Superdex S75, GE Healthcare). This also served to exchange the protein in a buffer optimized for NMR experiments (noted below) ...
-
bioRxiv - Cell Biology 2021Quote: ... The mass evaluated using UV as concentration source was 55.7 kDa for the 2 mg/ml sample.The Odinarchaeota samples were analysed by SEC-MALS (100 μl protein complex at 2 mg/ml) were passed over a Superdex 200 10/300 Increase GL column (GE Healthcare), in 20 mM Tris (pH 8.0) ...
-
bioRxiv - Cell Biology 2021Quote: ... and 2 mM DTT followed by size exclusion chromatography to remove any protein aggregates using a Superdex 75 column (GE Healthcare) in 25 mM HEPES (pH 7.5) ...
-
bioRxiv - Cancer Biology 2020Quote: ... purified RNA was electrophoresed in non-denaturing 2% agarose TBE gel and then gel was blotted onto an Hybound-N nylon membrane (RPN303N, GE Healthcare) by semidry electroblotting in 0.5× TBE buffer for 2 hours at 200mA ...
-
bioRxiv - Biophysics 2021Quote: ... 100-μl protein samples (at approximately 2 mg/ml) were loaded onto a Superdex 200 or 75 10/300 GL Increase size-exclusion chromatography column (GE Healthcare) in 20 mM Tris HCl ...
-
bioRxiv - Biophysics 2021Quote: ... Peak fractions were pooled, diluted ~5 fold with buffer 0 (20 mM HEPES, 2 mM DTT) and loaded onto a Q column (GE Healthcare). Rad33 was then eluted from the Q column using a linear gradient of Q buffer A (20 mM HEPES ...
-
bioRxiv - Neuroscience 2022Quote: ... Truncated mouse RANKL transcript (encoding amino acids 137-316 of mouse RANKL) was PCR amplified (forward primer: CACCCCCGGGCAGCGCTTCTCAGGAGCT, reversed primer: GAGACTCGAGTCAGTCTA TGTCCTGAAC) and then cloned into pGEX-5X-2 vector (GE Healthcare) between SmaI and XhoI sites ...