Labshake search
Citations for GE Life Sciences :
401 - 450 of 564 citations for 7 Nitro 2 tetralone since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... After dialysis the histones in 2 M NaCl were concentrated to a volume of 1 mL and purified using an Superdex 200 column (GE Healthcare) on an FPLC (Agilent) ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins were concentrated to 2 mL and further purified by size-exclusion chromatography using HiLoad 16/600 Superdex 200 (Ge healthcare).
-
bioRxiv - Biochemistry 2021Quote: ... The purified protein was then concentrated to 2 mL and purified by FPLC sizeexclusion chromatography using a Superdex 75 10/300 GL (GE Healthcare) column into 20 mM NaPO4 150 mM NaCl pH 7.5 ...
-
bioRxiv - Bioengineering 2020Quote: ... The ligase was inactivated with 2 M NaCl and the sample was injected into a Sephacryl S-1000 size exclusion column (GE Healthcare) to remove excess oligos and DNA ligase.
-
bioRxiv - Bioengineering 2020Quote: Binding of SARS-CoV-2 RBD to ACE2 –Fc and ACE2mod–Fc fusion proteins were measured using a Biacore T200 instrument (GE Healthcare). Fusion proteins were first immobilized at a coupling density of ∽1000 response units (RU ...
-
bioRxiv - Biochemistry 2021Quote: 50 μl of the N protein samples (1 mg/ml) purified according to protocols 1 or 2 were loaded onto a Superdex 200 Increase 10/300 column (GE Healthcare) pre-equilibrated with 20 mM HEPES ...
-
bioRxiv - Neuroscience 2020Quote: ... 150 mM NaCl) containing 5% skim milk (Meiji) and subjected to primary antibody for 2 h and HRP-conjugated secondary antibody (GE Healthcare) for 30 min ...
-
bioRxiv - Biophysics 2021Quote: ... The flow through containing SARS-CoV-2 Mpro was collected and further purified using size exclusion chromatography column (G-100, GE Healthcare,) equilibrated with 20 mM Tris ...
-
bioRxiv - Cell Biology 2021Quote: ... myogenic differentiation was induced by replacing the medium with differentiation medium (DM) consisting of DMEM supplemented with 2% horse serum (GE Healthcare) and PS ...
-
bioRxiv - Biochemistry 2020Quote: ... The cleaved protein was separated from any His6-tagged species by passage through the Ni+2-NTA HisTrap HP column and purified further using size-exclusion chromatography (Superdex S75, GE Healthcare). This also served to exchange the protein in a buffer optimized for NMR experiments (noted below) ...
-
bioRxiv - Cell Biology 2021Quote: ... The mass evaluated using UV as concentration source was 55.7 kDa for the 2 mg/ml sample.The Odinarchaeota samples were analysed by SEC-MALS (100 μl protein complex at 2 mg/ml) were passed over a Superdex 200 10/300 Increase GL column (GE Healthcare), in 20 mM Tris (pH 8.0) ...
-
bioRxiv - Cell Biology 2021Quote: ... and 2 mM DTT followed by size exclusion chromatography to remove any protein aggregates using a Superdex 75 column (GE Healthcare) in 25 mM HEPES (pH 7.5) ...
-
bioRxiv - Plant Biology 2020Quote: ... Desalting columns (NAP-5 and PD-10) and N-[6-(Biotinamido)hexyl]-3’-(2’-pyridyldithio)proprionamide (HPDP-biotin) were purchased from GE Healthcare and Pierce ...
-
bioRxiv - Cancer Biology 2020Quote: ... purified RNA was electrophoresed in non-denaturing 2% agarose TBE gel and then gel was blotted onto an Hybound-N nylon membrane (RPN303N, GE Healthcare) by semidry electroblotting in 0.5× TBE buffer for 2 hours at 200mA ...
-
bioRxiv - Biophysics 2021Quote: ... 100-μl protein samples (at approximately 2 mg/ml) were loaded onto a Superdex 200 or 75 10/300 GL Increase size-exclusion chromatography column (GE Healthcare) in 20 mM Tris HCl ...
-
bioRxiv - Biophysics 2020Quote: ... followed by 2 CV of 100% IEX buffer B using an ÄKTA Pure fast protein liquid chromatography (FPLC) system (GE Healthcare). To determine the point of elution of aSyn from the chromatography column protein fractions which were collected and monitored on absorption at 280 nm were ran on a 4-12% Bis-Tris gel (Invitrogen ...
-
bioRxiv - Biophysics 2021Quote: ... Peak fractions were pooled, diluted ~5 fold with buffer 0 (20 mM HEPES, 2 mM DTT) and loaded onto a Q column (GE Healthcare). Rad33 was then eluted from the Q column using a linear gradient of Q buffer A (20 mM HEPES ...
-
bioRxiv - Neuroscience 2022Quote: ... Truncated mouse RANKL transcript (encoding amino acids 137-316 of mouse RANKL) was PCR amplified (forward primer: CACCCCCGGGCAGCGCTTCTCAGGAGCT, reversed primer: GAGACTCGAGTCAGTCTA TGTCCTGAAC) and then cloned into pGEX-5X-2 vector (GE Healthcare) between SmaI and XhoI sites ...
-
bioRxiv - Immunology 2022Quote: The binding kinetics and affinity of recombinant monoclonal antibodies for the SARS-CoV-2 RBD protein (SinoBiological) were analyzed by SPR (Biacore T200, GE Healthcare). Specifically ...
-
bioRxiv - Biophysics 2022Quote: Binding kinetics of ACE2 and SARS-CoV-2 RBDs were determined by surface plasmon resonance using a Biacore S200 (GE Healthcare). All experiments were performed in a running buffer composed of 10 mM HEPES ...
-
bioRxiv - Biochemistry 2022Quote: The binding kinetics of mAbs to SARS-CoV-2 Delta-RBD or Omicron-RBD monomer were analyzed using SPR (Biacore 8K; GE Healthcare). Specifically ...
-
bioRxiv - Immunology 2022Quote: ... 500 μL of the proteins ranging from 2 mg/mL – 4 mg/mL concentration were loaded on an analytical Superose 6 Increase 10/300 column (GE Healthcare) and eluted in 1x PBS (pH 7.4 ...
-
bioRxiv - Biophysics 2022Quote: ... Peak fractions were diluted with 2 volumes of buffer H and loaded onto a 1-mL SP HP column (GE Healthcare) and washed with buffer C (50 mM HEPES pH 7.5 ...
-
bioRxiv - Biochemistry 2022Quote: ... The supernatant was supplemented with 4 mM CaCl2 and stirred for 2 h in 4°C with CaM-Sepharose beads (GE Healthcare), pre-equilibrated with binding buffer (50 mM Tris/HCl pH 7.2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... the gel was washed with the wash buffer and the IF3-bound complexes were eluted by additional incubation of 2 h with the PreScission protease (GE Healthcare) (2 U/μl).
-
bioRxiv - Microbiology 2022Quote: ... or His-NTV-AviTag (80 µl at 2 mg/ml) were injected on a Superdex 200 increase 10/300 GL column (GE Healthcare), equilibrated at 4°C with a buffer containing 25 mM HEPES pH 7.5 ...
-
bioRxiv - Plant Biology 2022Quote: ... The obtained pellet was resuspended in 2 mL of washing buffer and loaded on top of a 28% (v/v) Percoll (GE Healthcare) continuous gradient with a 0% to 4% (w/v ...
-
bioRxiv - Immunology 2022Quote: SPR screening and affinity measurements of monoclonal Fabs binding to SARS-CoV-2 spike proteins were performed using a Biacore S200 instrument (Cytiva, formerly GE Healthcare) in HBS-EP+ 1X running buffer ...
-
bioRxiv - Biochemistry 2022Quote: Antibody binding to SARS-CoV-2 spike was assessed using SPR on a Biacore T-200 (Cytiva, MA, formerly GE Healthcare) with HBS buffer supplemented with 3 mM EDTA and 0.05% surfactant P-20 (HBS-EP+ ...
-
bioRxiv - Biochemistry 2022Quote: (His)6-GST-CAPN7(MIT)2 was bound to GST-sepharose beads (10 mL,GE Healthcare Life Sciences, USA, 6 h), washed with 1 L wash buffer ...
-
bioRxiv - Neuroscience 2020Quote: T1-weighted images providing high anatomical detail were acquired on 2 GE 3T Discovery 750× scanners (GE Healthcare, Waukesha, WI, USA) with an 8-channel phased array head coil (scanner 1 N=336 ...
-
bioRxiv - Microbiology 2020Quote: ... Aliquots were taken every 30 minutes for a period of 2 hours and quenched in 3ml of 5% trichloroacetic acid (TCA) on Whatman-glass fiber filters (GE healthcare) and washed 3 times with 1ml ethanol to dry the filter ...
-
bioRxiv - Neuroscience 2020Quote: Dynamic PET/CT imaging (2-3h) with arterial blood sampling was performed on Monkey 3 and Monkey 4 using a Discovery MI (GE Healthcare). Each animal had two baseline scans which were separated by one month for Monkey 3 and by one year for Monkey 4 ...
-
bioRxiv - Molecular Biology 2019Quote: ... (amino acids 2-241 fused to 6 x his) were expressed in BL21 cells and purified on glutathione-linked sepharose beads (GE healthcare) or Ni-NTA-Agarose (GE healthcare ...
-
bioRxiv - Microbiology 2021Quote: ... Gels were dried and exposed on a phosphoscreen for 2-4 days and visualized using a Typhoon Imaging System (GE Healthcare). Bands were quantified using band densitometry using the ImageQuant software (GE Healthcare).
-
bioRxiv - Biochemistry 2021Quote: The binding affinities of full IgG antibodies to SARS-CoV-2 spike protein were determined using surface plasmon resonance (SPR) and a BIAcore T200 instrument (GE Healthcare) at 25°C ...
-
bioRxiv - Bioengineering 2020Quote: ... 100 μl of freshly purified protein (concentration 1-2 mg/ml) was injected on a Superdex 75 300/10 GL column (GE Healthcare) at a flow rate of 0.5 ml/min ...
-
bioRxiv - Immunology 2022Quote: ... mononuclear cells were isolated by density gradient centrifugation of PBS-diluted buffy coat/blood (1:2) over Ficoll-Paque Plus (GE Healthcare). The PBMC layer was carefully removed and washed 3 times with PBS.
-
bioRxiv - Cancer Biology 2022Quote: ... Blood was diluted 1:2 with 1× phosphate-buffered saline (PBS) and transferred to a 50 ml falcon tube with Ficoll-Paque PLUS (GE Healthcare) at a 1:2 ratio ...
-
Phosphorylation of the Smooth Muscle Master Splicing Regulator RBPMS Regulates its Splicing ActivitybioRxiv - Molecular Biology 2022Quote: ... 50-μl protein samples (at approximately 2 mg/ml) were loaded onto a Superdex 75 10/300 GL increase size-exclusion chromatography column (GE Healthcare) in 10 mM HEPES ...
-
bioRxiv - Zoology 2019Quote: The midgut BBMV proteins were subjected to clean-up using the 2-D Clean-up Kit (GE Healthcare Life Sciences, USA) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... cDNAs coding for HSC70 and HSC70-SBD were cloned in BamHI and XhoI sites of pGEX-5X-2 bacterial expression vector (GE Healthcare). Sequences of all the mutants were confirmed by automated DNA sequencing.
-
bioRxiv - Biophysics 2019Quote: ... The eluted Sox2 and Oct4 were refolded by dialyzing to 2 M urea and then to 0 urea using a desalting column (GE healthcare). Further purification was carried out by gel filtration using a Superdex 200 10/300 GL column (GE Healthcare) ...
-
bioRxiv - Cell Biology 2019Quote: ... phenolics and nucleic acids in extracted protein were removed using the 2-D Clean-Up kit (GE Healthcare, Piscataway, NJ, USA) according to the manufacturer’s instructions ...
-
Bridging of nucleosome-proximal DNA double-strand breaks by PARP2 enhances its interaction with HPF1bioRxiv - Biochemistry 2019Quote: ... diluted by half to lower NaCl concentration to 250 mM and applied at 2 mL/min onto a HiTrap Heparin HP 5 mL column (GE Healthcare) previously equilibrated in Tris 50 mM ...
-
bioRxiv - Biophysics 2019Quote: ... The reaction was incubated at 37°C for 2-3 hours on an orbital shaker and loaded onto an anion-exchange colum (1 ml DEAE FF, GE Healthcare) equilibrated in 50 mM Tris-HCl pH 7.4 ...
-
bioRxiv - Microbiology 2020Quote: ... M was concentrated to 2 ml using Vivaspin20 columns (SartoriusStedimBiotec) and purified on a HiLoad 10/600 Superdex S200 column (GE Healthcare) in 50 mM NaH2PO4-Na2HPO4 ...
-
bioRxiv - Cell Biology 2019Quote: ... the primary antibody was visualized using 2~5 μg/ml secondary antibody towards specific species of primary antibody labeled with Cy3B (GE Healthcare) or Atto 488 (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2019Quote: ... TolA was loaded into the cell and synthetic TolB peptide (residues 22-33; 2 mM) loaded into the syringe of an iTC200 microcalorimeter (Microcal/GE Healthcare). Titration consisted of 20 injections (1 x 0.4 μl ...
-
bioRxiv - Microbiology 2020Quote: ... to a volume of 2 ml and applied to size exclusion chromatography (SEC; HiLoad 26/600 Superdex 200 pg, GE Healthcare), After SEC ...