Labshake search
Citations for GE Life Sciences :
4601 - 4650 of 4670 citations for Rat Androgen dependent TPF1 regulating protein ADTRP ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: Gel-purified PCR products were used to generate radio-labeled probes to detect CLN2 and ACT1 mRNAs by Northern blotting (oligonucleotides: TCAAGTTGGATGCAATTTGCAG, TGAACCAATGATCAATGATTACGT; ACT1 oligonucleotides: TCATACCTTCTACAACGA-ATTGAGA and ACACTTCATGATGGAGTTGTAAGT. Probes were labeled using the Megaprime DNA labelling kits (GE Healthcare). Northern blotting was carried out as previously described (Cross and Tinkelenberg ...
-
bioRxiv - Plant Biology 2023Quote: ... DNA was isolated from leaf tissue of 4-wk-old plants by using Illustra Nucleon Phytopure extraction kit reagents (GE Healthcare). DNA was isolated from agarose gel pieces using QIAquick gel extraction kit (Qiagen).
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCR products amplified with primers Aeatro-Nix-F1/R1 were purified with GFX PCR DNA and Gel Band Purification Kit (GE Healthcare) and cloned into pJET1.2/blunt cloning vector ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCR products amplified with primers Aeatro-Nix-F2/R2 were purified with GFX PCR DNA and Gel Band Purification Kit (GE Healthcare) and directly sequenced.
-
bioRxiv - Biochemistry 2022Quote: ... The antibodies were captured on a CM5 chip immobilized with anti-human IgG Fc using a Human Antibody Capture Kit (GE Healthcare), according to the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2023Quote: ... were loaded with 10 μL of Aβ42 oligomer samples alongside the Amersham High Molecular Weight calibration kit for native electrophoresis (GE Healthcare, USA). The gels were run at 4°C using the electrophoresis system according to the Invitrogen instructions (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... blots incubated with HPR-conjugated secondary antibodies were developed using HRP substrate (EZ-ECL chemiluminescence detection kit for HRP, Geneflow Ltd.) followed by exposure on an ImageQuant chemiluminescent imaging system (GE Healthcare). For blots probed with fluorescent secondary antibodies ...
-
bioRxiv - Immunology 2024Quote: ... An Fc capture chip was produced by amine coupling of anti-mouse IgG antibody to a CM5 chip using a commercial Fc Capture Kit (GE Healthcare). First ...
-
bioRxiv - Immunology 2024Quote: ... Detection was performed with the use of Pierce Fast Western Blot Kit in an Amersham Imager 600 (GE Healthcare Life Sciences)..
-
bioRxiv - Microbiology 2024Quote: Single Cononympha cells were collected using a Leica AM6000 micromanipulation system and subjected to whole genome amplification (WGA) using the illustra GenomiPhi V2 kit (GE Healthcare) as described previously [30] ...
-
bioRxiv - Genetics 2024Quote: ... and 5% dextran sulfate) at 65°C probed with 32P-labeled V5 DNA probes prepared via Amersham Megaprime DNA labeling kit (GE Healthcare) and Illustra ProbeQuant columns (GE Healthcare) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we introduced random mutations with Multi Primed Rolling Circle Amplification using the Illustra™ TempliPhi™ DNA Amplification Kit (GE Healthcare) with 2 mM of MnCl2 added to a final reaction volume of 10.8 µl ...
-
bioRxiv - Physiology 2022Quote: ... at a dilution of 1:2000 was done for 1 hour at RT in blocking buffer and detection was done using ECL detection kit (RPN2235, GE Healthcare, USA). Images were taken by the ImageQuant LAS500 (GE healthcare ...
-
bioRxiv - Genetics 2020Quote: ... High molecular weight DNA from concentrated coral sperm was extracted using the illustra Nucleon Phytopure kit (GE Healthcare Life Science, Pittsburgh, PA) following the manufacturer’s instructions and eluted in nuclease-free water ...
-
bioRxiv - Cell Biology 2019Quote: ... 6His-Cdc11-SNAP was biotinylated with BG-Biotin and subsequently immobilized on a CAP chip (Biotin Capture Kit; GE Healthcare, Freiburg, Germany). Preparation of the chip ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA from brain tissues or culture cells were extracted using the illustra RNAspin Mini RNA Isolation Kit (GE Healthcare Life Sciences) for reverse transcription with the High-Capacity cDNA Reverse Transcription Kits (ABI Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... according to manufacturer’s instructions and circular DNA was enriched by rolling circle amplification (RCA) with TempliPhi™ amplification kit (GE Healthcare, USA).
-
bioRxiv - Cancer Biology 2022Quote: ... Membranes were further washed three times for five minutes in PBS-T before being visualised using ECL kit (GE Healthcare Cat. #RPN2232) and ChemiDoc Imaging System (BioRad) ...
-
bioRxiv - Cell Biology 2022Quote: ... Equal amounts of protein samples were subjected to immunoblotting for target proteins and immunoreactive bands were visualized using the Amersham ECL western blotting detection kit according to the manufacturer’s protocol (GE Healthcare, Piscataway, NJ). Antibodies for GAPDH or Cyclophilin B were used as loading controls.
-
bioRxiv - Genomics 2019Quote: ... and whole genome amplification was achieved by multiple displacement amplification with Phi29 DNA polymerase and the Illustra GenomiPhi v.2 kit (GE Healthcare, 25660032). Amplified genomic DNA (70 ng ...
-
bioRxiv - Molecular Biology 2019Quote: ... random hexamer primers were used following the manufacturer’s instructions for the GenomiPhi V2 DNA Amplification Kit (catalogue # 45-001-221, GE Healthcare Life Sciences).
-
bioRxiv - Genetics 2020Quote: We performed WGA on each F2 gDNA cercarial sample using the Illustra GenomiPhi V2 DNA Amplification kit (GE Healthcare Life Sciences, USA) according to Le Clec’h et al ...
-
bioRxiv - Microbiology 2021Quote: ... Membranes were developed using the ECL Prime kit (Cytiva, Marlborough, MA) and imaged using Amersham Imager 600 (GE Healthcare, Amersham, Buckinghamshire, UK). Fractionation was repeated with 3 independent sets of cultures and one set of immunoblots is presented as a representative.
-
bioRxiv - Microbiology 2020Quote: ... extracted DNA was subjected to multiple displacement amplification (MDA) using the illustra GenomiPhi V2 DNA amplification kit (GE Healthcare, Piscataway, NJ, USA), following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... total RNA from 30–50 light-treated or dark control embryos was extracted using the illustra™ RNAspin Mini kit (GE Healthcare). 1 μg total RNA was used for reverse transcription with qScript XLT cDNA SuperMix (Quantabio) ...
-
bioRxiv - Immunology 2021Quote: ... 10μg/mL of C-terminal 6X-His tag containing recombinant SARS-CoV-2 Spike protein was captured at a flow rate of 10μL/minute for 180 seconds onto carboxymethylated (CM5) dextran sensor chips immobilised with anti-His mAb using EDC/NHS amine coupling kit (GE Healthcare, Australia). The sensor chips were equilibrated with running buffer [HEPES buffer (HBS-EP+ ...
-
bioRxiv - Genomics 2021Quote: Single-cell WGA was done on 10~17 μm or 17~25 μm C1 DNA-Seq IFC (Fluidigm, 100-5763 or 100-5764) via multiple displacement amplification method using illustra GenomiPhi V2 DNA Amplification Kit (GE Healthcare, 25660031). The WGA products from single cells were mixed according to their tissue origin ...
-
bioRxiv - Molecular Biology 2022Quote: ... The probes (PCR amplified from gDNA or binary plasmid using the oligos in Supplemental Table S3) were internally labelled using [α-P32] dCTP (BRIT India) using Rediprime labelling kit (GE healthcare) and hybridisation and washes were performed as described ...
-
bioRxiv - Microbiology 2022Quote: ... whole genome amplification was carried out using the multiple displacement amplification technique with the Genomiphi V2 DNA Amplification Kit (GE Healthcare, USA). This approach has been widely used previously in various works [18–20] ...
-
bioRxiv - Neuroscience 2024Quote: ... the membranes were further washed 3x with TBST and once with TBS before visualization of the resulting bands with ECL Advanced Western Blotting Detection Kit (GE Healthcare, #RPN2135) in an Amersham Imager 600 (GE Healthcare) ...
-
bioRxiv - Microbiology 2023Quote: ... All genes used in the curves were purified with the IllustraTM GFXTM PCR DNA and Gel Band Purification Kit (GE Healthcare, UK) for better efficiency of the standard curves ...
-
bioRxiv - Pathology 2023Quote: The circular DNA genomes of MSV were first amplified by rolling circle amplification (RCA) according to the manufacturer’s protocol (TempliPhiTM kit, GE Healthcare, Munich, Germany). Then ...
-
bioRxiv - Microbiology 2023Quote: ... Anti-rabbit immunoglobulin AP-conjugated secondary antibody was used and reaction results were obtained using CDP Start Detection Reagent kits (GE Healthcare, USA) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein bands were visualized using an ECL kit (Ez WestLumi plus, ATTO, Tokyo, Japan) via chemiluminescence (ImageQuant LAS 4000 mini, GE Healthcare, USA) and quantified using NIH ImageJ software (National Institutes of Health ...
-
bioRxiv - Cell Biology 2020Quote: ... The two fragments were fused by PCR to obtain a product corresponding to the 783 bp coding sequence of TMEM70 transcript variant 1 that was cloned into pMOSblue vector using the Blunt-Ended PCR Cloning Kit (GE Healthcare Life Sciences) to generate the pMOS-TMEM70 plasmid ...
-
bioRxiv - Physiology 2020Quote: Distinct bands of correct size were cut from 1.5% agarose gel and isolated using illustra GFX PCR and Gel Band Purification Kit (GE Healthcare, Chicago, IL, USA), following manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2019Quote: Samples each containing 2 μg Chl a of ΔpsbO-PSII-M and ΔpsbO-NRC were precipitated using the 2D Cleanup Kit (GE Healthcare, Chicago, IL) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... PCR reactions were analyzed by agarose gel electrophoresis with ethidium bromide staining and purified using the Illustra GFX PCR DNA and Gel Band Purification kit (GE Healthcare, Chicago, IL). Reactions (10 μL ...
-
bioRxiv - Cell Biology 2021Quote: ... or anti-Scp160 antibodies (Gift of R. Jansen, U. Tuebingen) was performed using the Amersham ECL Western Blotting Detection Kit (GE Healthcare Life Sciences). Quantification of protein bands was performed using ImageJ software.
-
bioRxiv - Synthetic Biology 2022Quote: CM3 sensor chips were coupled with streptavidin to near saturation (typically between 4000 and 7000 RU) using the amine coupling kit (GE Healthcare Life Sciences). After streptavidin was coupled ...
-
bioRxiv - Immunology 2020Quote: CM5 sensor chips were coupled with streptavidin to near saturation (typically between 4000 and 7000 RU) using the amine coupling kit (GE Healthcare Life Sciences). After streptavidin was coupled ...
-
bioRxiv - Developmental Biology 2020Quote: ... Bound Pnr 1-291 was identified by Western-blot (1:5000 rabbit anti-HA polyclonal) using an ECL kit (Amersham GE Healthcare Life Sciences) based on the manufacturer’s recommendations ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Five microliters of each DNA sample were amplified in a 50-ul reaction using an Illustra GenomiPhi DNA V3 DNA amplification kit (GE Healthcare, United Kingdom).
-
bioRxiv - Epidemiology 2021Quote: ... CM5 chips for surface plasmon resonance (SPR) assay and Cytometric Bead Array (CBA) Mouse Immunoglobulin Isotyping Kit were purchased from GE HealthCare (Boston, USA). Ninety-six-well MultiScreen HTS plates were purchased from Millipore (Billerica ...
-
bioRxiv - Plant Biology 2022Quote: Leaf samples from ino-4 and ino-4 i20 plants were separately pooled and DNA extracted with Nucleon Phytopure DNA extraction kit (GE Healthcare, Pittsburgh, PA), according to the provider’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... was processed for amplification of complete genome of the virus by rolling circle amplification (RCA) method using TempliPhi illustra amplification kit (GE Healthcare, Piscataway, NJ). The resulting RCA product (2 μL ...
-
bioRxiv - Neuroscience 2023Quote: ... and digested using the Macs Neural tissue Dissociation kit (Miltenyl Biotec) and subsequent percoll gradients (30% percoll [GE healthcare], 10% fetal bovine serum) was used to purify myeloid cells and incubated to antibodies against Cd11b and CD45 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Whole genome DNA was amplified using 1 μl polymerase enzyme from the illustra GenomiPhi V2 DNA Amplification Kit (GE Healthcare Cat# 25-6600-32) and 9 μl of sample with the following conditions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Chemiluminescence detection was performed using the ECL Prime Western Blotting kit (GE-healthcare, RPN2232) and developed on a ImageQuant LAS 4000 (GE healthcare, 28-9558-10). Secondary antibodies for infrared fluorescence detection were donkey anti-rabbit-IRDye® 800CW (Rockland ...
-
bioRxiv - Genomics 2020Quote: ... 2 μL of each field sample was subject to whole genome amplification using the illustra Genomiphi V2 DNA amplification kit (GE Healthcare Life Sciences, Australia) for 2 hours at 30°C followed by heat inactivation at 65°C for 10 minutes ...