Labshake search
Citations for GE Life Sciences :
2951 - 3000 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... Ligands were immobilized on a CM5 chip (GE Healthcare # 29104988) via amine coupling ...
-
bioRxiv - Bioengineering 2023Quote: ... and 100 µl of the sample was injected into a Superdex 75 300/10 GL column (GE Healthcare) with a flow rate of 0.5 ml/min ...
-
bioRxiv - Bioengineering 2023Quote: ... All proteins were purified using an ÄKTA pure system (GE healthcare) with either Ni-NTA affinity or protein A affinity columns followed by size exclusion chromatography ...
-
bioRxiv - Bioengineering 2023Quote: ... Data were fit with 1:1 Langmuir binding model within the Biacore 8K analysis software (GE Healthcare #29310604).
-
bioRxiv - Pathology 2023Quote: ... The fusion proteins were purified with glutathione Sepharose 4B (GE Healthcare) for GST-fused proteins ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Images were taken using an ImageQuant 400 Digital Imager (GE Healthcare). Image intensities of bands of interest were determined using ImageJ’s gel analysis plug-in ...
-
bioRxiv - Neuroscience 2023Quote: SPR analyses were performed using a Biacore T200 instrument (GE Healthcare). Purified recombinant NRX1β ectodomain fused to human immunogloblin Fc (NRX1β-Fc ...
-
bioRxiv - Neuroscience 2023Quote: ... lysates were incubated with the primary antibody at 4°C for 2 h or overnight and then incubated with protein G- or protein A-Sepharose (GE Healthcare) for 2 h ...
-
bioRxiv - Neuroscience 2023Quote: ... Data analysis was performed using BIA Evaluation Software (GE Healthcare) and fit to a one-site Langmuir adsorption model.
-
bioRxiv - Pathology 2023Quote: ... Proteins were blotted onto nitrocellulose membranes (Amersham, GE Healthcare, Chicago, IL, USA). Western blotting was performed with the use of primary antibodies listed in Table 2 ...
-
bioRxiv - Pathology 2023Quote: ... purified by 30% Percoll (GE Healthcare, Chicago, IL; 17089101) density gradient separation ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... High-throughput imaging was carried out using the In Cell Analyzer 2000 with a 20x objective (GE Healthcare). Images were batch processed through an imaging processing software ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... High-throughput imaging was carried out using the In Cell Analyzer 2000 (GE Healthcare). Cell viability was quantified by using the propidium iodide signal to count the total number of cells per well and using the DAPI signal to count the total number of dead cells per well in the GE Developer Toolbox v1.9.1 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... High-throughput imaging was carried out using the In Cell Analyzer 2000 (GE Healthcare). Cell viability was quantified by using the propidium iodide signal to count the total number of cells per well and using the DAPI signal to count the total number of dead cells per well in the GE Developer Toolbox v1.9.1 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Images of the resulting blots were taken with an ImageQuant LAS 4000 (GE Healthcare). After incubation of the protein solutions ...
-
bioRxiv - Pathology 2023Quote: ... packed with Ni2+ nitrilotriacetic acid (NTA)-sepharose (GE Healthcare) were used ...
-
bioRxiv - Neuroscience 2023Quote: ... run and transferred into a PVDF low fluorescent membrane (GE healthcare). After blocking ...
-
bioRxiv - Neuroscience 2023Quote: ... Biotinylated proteins were isolated using streptavidin magnetic sepharose beads (GE Healthcare Cat# 28-9857-38) overnight at 4°C and then washed seven times in RIPA buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... On day 2, cells were changed with fresh media containing RMPI1640 (Thermo, 21870) supplemented with 0.2% Hyclone FBS (GE Healthcare, SH30070.03) 100 ng/mL Activin A (R&D Systems ...
-
bioRxiv - Cell Biology 2023Quote: ... equipped with a Superdex 200 increase 10/300 GL column (GE Healthcare, Solingen, Germany) and buffer containing 50 mM HEPES-NaOH ...
-
bioRxiv - Cell Biology 2023Quote: ... SoftWoRx software (Applied Precision, Issaquah, WA) and GFP ...
-
bioRxiv - Cell Biology 2023Quote: ... The cleared lysate was incubated for 2 h with Glutathione 4B Sepharose (GE Healthcare, Germany) followed by washing of the Sepharose with 50 mM HEPES-NaOH ...
-
bioRxiv - Cell Biology 2023Quote: GST-tagged proteins were affinity-purified using glutathione-Sepharose 4B beads (GE Healthcare) according to the manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... Antibodies and associated DNA were then isolated using Gammabind G Sepharose beads (GE Healthcare Bio, catalog # 17-0885-01). Crosslinks were reversed by incubating samples and input at 65°C for at least 6 hours ...
-
bioRxiv - Cell Biology 2023Quote: ... gels were transferred to a Hybond-XL nylon membrane (GE Healthcare) using alkaline capillary transfer ...
-
bioRxiv - Cell Biology 2023Quote: Gel-purified PCR products were used to generate radio-labeled probes to detect CLN2 and ACT1 mRNAs by Northern blotting (oligonucleotides: TCAAGTTGGATGCAATTTGCAG, TGAACCAATGATCAATGATTACGT; ACT1 oligonucleotides: TCATACCTTCTACAACGA-ATTGAGA and ACACTTCATGATGGAGTTGTAAGT. Probes were labeled using the Megaprime DNA labelling kits (GE Healthcare). Northern blotting was carried out as previously described (Cross and Tinkelenberg ...
-
bioRxiv - Immunology 2023Quote: ... and developed with an ECL signal detection kit (GE Healthcare).
-
bioRxiv - Immunology 2023Quote: ... pre-equilibrated with PBS using an AKTA Prime Plus Liquid Chromatography System (GE Healthcare). Afterwards ...
-
bioRxiv - Immunology 2023Quote: ... HRP-labeled anti-M13 phage antibody diluted 1:3000 (GE Healthcare, RPN420) was used as a detection system ...
-
bioRxiv - Immunology 2023Quote: ... Correctly conformed HLA.A2-peptide complexes were purified using Ni2+-NTA agarose chromatography (HisTrap excel, 2 × 5 ml2 columns connected in series; GE Healthcare Life Sciences) followed by size-exclusion chromatography (Superdex 200 10/300 GL ...
-
bioRxiv - Immunology 2023Quote: ... and subjected to size-exclusion chromatography (Superdex 200 increase 10/300 gl and Superdex 75 Increase 10/300 GL, GE Healthcare Life Sciences) and anion-exchange chromatography (Mono Q 5/50 GL ...
-
bioRxiv - Microbiology 2023Quote: ... Synchronisation of parasite cultures were done as described previously (Harris et al., 2005) by isolating mature schizonts by centrifugation over 70% (v/v) isotonic Percoll (GE Healthcare, Life Sciences) cushions ...
-
bioRxiv - Immunology 2023Quote: ... Nbs from PE were purified using IMAC Hi-Trap columns (GE Healthcare, 17092003) following manufacturer’s instructions and eluted using 300 nM Imidazole ...
-
bioRxiv - Immunology 2023Quote: ... Monomeric protein was purified using Superdex200 (GE Healthcare) size-exclusion chromatography column on an AKTA Pure (Cytvia).
-
bioRxiv - Microbiology 2023Quote: ... His6SUMO fusion products were then purified using a 5mL HisTrap HP (GE Healthcare) on an AKTA pure with stepwise imidazole·HCl increases from 15mM ...
-
bioRxiv - Microbiology 2023Quote: ... equilibrated with buffer A (50 mM Tris-HCl at the appropriate pH, 300 mM NaCl) on an AKTÄ explorer 10S FPLC system (GE Healthcare). The column was washed with 10 column volumes of buffer A ...
-
bioRxiv - Immunology 2023Quote: ... SPR experiments were performed with a Biacore T200 instrument (GE Healthcare). All experiments were conducted in degassed and filtered HBS-EP ...
-
bioRxiv - Immunology 2023Quote: ... followed by size-exclusion chromatography (Superdex 200 10/300 GL; GE Healthcare Bio-Sciences). cDNAs encoding the extracellular portions of human proteins ICAM-1 (UniProt ...
-
bioRxiv - Immunology 2023Quote: ... and Percoll from GE Healthcare (Chicago, IL, USA). Ketamine was from Richter Pharma (Wels ...
-
bioRxiv - Immunology 2023Quote: ... which was further purified by HiTrap SP cation exchange chromatography (GE Healthcare Life Sciences).
-
bioRxiv - Cell Biology 2023Quote: The FRAP experiments were carried out on a DeltaVision Elite microscope with the Quantitative Laser Module (Applied Precision) and Pco-Edge 4.2 sCMOS camera (Photometrics) ...
-
bioRxiv - Cancer Biology 2023Quote: ... was added to membranes and immunoblots were imaged using an Amersham Imager 600 (GE Healthcare).
-
bioRxiv - Cell Biology 2023Quote: ... The proteins were further purified using anion-exchange chromatography (Source 15Q, GE Healthcare) using a salt gradient from 0 to 1 M NaCl in a buffer containing 20 mM TrisHCl ...
-
bioRxiv - Biochemistry 2023Quote: ... Membranes were imaged on an Amersham Typhoon NIR laser scanner (GE Healthcare).
-
bioRxiv - Biochemistry 2023Quote: ... using a hollow fiber cartridge with a surface area of 4,800 cm2 and a nominal molecular weight cutoff (NMWC) of 10 kDa (GE Healthcare). All chromatography procedures were carried out at 4°C using either an ÄKTA express or ÄKTA pure chromatography system (GE Healthcare) ...
-
bioRxiv - Biochemistry 2023Quote: ... All chromatography procedures were carried out at 4°C using either an ÄKTA express or ÄKTA pure chromatography system (GE Healthcare). 1 mL StrepTrapTM HP (cat# 28907546 ...
-
bioRxiv - Biochemistry 2023Quote: ... The SIRT6-145 base pair / SIRT6-172 base pair nucleosome samples were first purified using a Superdex 200 column (GE Healthcare) and then stabilized using the GraFix method (37) ...
-
bioRxiv - Biochemistry 2023Quote: ... The octamer in refolding buffer was purified by size exclusion chromatography on a Superdex 200 16/600 column (GE healthcare). Nucleosomes were assembled by incubating purified Widom 601 DNA and histone octamers assembled from individual histone or polycistronic histones and dialyzed overnight with gradient salt dialysis using a peristaltic pump (Gilson Rapid Pump) ...
-
bioRxiv - Biochemistry 2023Quote: ... the fractions containing SUV420H1 were purified on HiLoad Superdex 200 10/300 (GE Healthcare) size-exclusion chromatography column (S200 Buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... Octamer was subsequently followed by further purification by Superdex 200 16/600 column (GE Healthcare) size-exclusion chromatography column (S200 Buffer ...