Labshake search
Citations for GE Life Sciences :
2451 - 2500 of 4575 citations for Mono N Butyl Phthalate 100 Ug Ml In Mtbe Ring 1 2 13C2 Dicarboxyl 13C2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... Collected fractions containing FANCI were diluted to ∼100 mM NaCl concentration and loaded onto a HiTrap Heparin HP affinity column (GE Healthcare Life Sciences). Using a shallow NaCl gradient ...
-
bioRxiv - Molecular Biology 2019Quote: ... The elution was then diluted to ∼100 mM NaCl concentration and loaded onto a HiTrap Heparin HP affinity column (GE Healthcare Life Sciences). Using a shallow NaCl gradient ...
-
bioRxiv - Biochemistry 2019Quote: Recombinant GST and GST-HIT proteins were produced by IPTG induction of transformed BL21 Rosetta strains and purified on 100 μl of Glutathione Sepharose 4B beads (17075601, GE Healthcare Life Sciences), for 4-5 hours at 4°C ...
-
bioRxiv - Physiology 2021Quote: ... on an ÄKTA Pure Protein Purification System equipped with a Superdex 75 10/300 GL gel-filtration column and a 100 µL loop (GE Healthcare Life Sciences). Buffer was 10 mM HEPES ...
-
bioRxiv - Microbiology 2020Quote: Association and dissociation reactions of GP96 to pneumococcal Ali proteins were analyzed using a BIAcore optical biosensor (BIAcore X-100 system, GE Healthcare Life Sciences), as previously described48 ...
-
bioRxiv - Cancer Biology 2020Quote: Talin R13–DD wildtype and R13–DD L2509P were analysed by SEC–MALS at a concentration of 100 μM at room temperature with a Superdex 75 column (GE Healthcare Life Sciences). Eluted proteins were analysed with Viscotek SEC–MALS 9 and Viscotek RI detector VE3580 (Malvern Panalytical) ...
-
bioRxiv - Biochemistry 2024Quote: ... protein was loaded onto a pre-equilibrated (50 mM Tris-HCl 7.5 at 4 °C and 100 mM sodium chloride) Superdex 16/600 size exclusion column (GE Life Sciences, Chicago, IL) following Ni-NTA affinity chromatography to remove any protein aggregate ...
-
bioRxiv - Microbiology 2024Quote: ... The His-tag S protein was purified by gel filtration using the Akta explorer 100 system with a high-load Superdex pg 200 16/600 column (GE Life Sciences, USA). Main peak fraction was collected ...
-
bioRxiv - Cell Biology 2023Quote: ... The CM was then concentrated by tangential-flow filtration with a 100 kDa molecular weight cut-off filter membrane cartridge (GE Healthcare, Chicago, USA) and buffer exchange was performed by diafiltration with EDB1 (Dilution Buffer with 2%Trehalose in PBS) ...
-
bioRxiv - Biophysics 2023Quote: ... The digested protein was concentrated using a 100 kDa concentrator and further purified on a Superose 6 Increase 10/300 gel filtration column (GE Healthcare Life Sciences) equilibrated in an Mg2+-containing buffer (20 mM Tris pH 8.0 ...
-
bioRxiv - Cell Biology 2023Quote: ... High resolution images of individual PvLS parasites and PHH nuclei were obtained by capturing 8 planes in the Z dimension using a 100×objective on Deltavision Core (GE Healthcare Life Sciences) and deconvoluted using softWoRx (GE Healthcare Life Sciences ...
-
bioRxiv - Cell Biology 2023Quote: ... The mixture was separated by ultracentrifugation at 100 000 x g for 30 min at 4 °C and supernatant was loaded onto a HisTrap HP column (GE Healthcare, Freiburg, Germany) preequilibrated with 50 mM Tris ...
-
bioRxiv - Biochemistry 2023Quote: ... 10 mM Magnesium acetate and 0.01% Tween 20) and compared to the activity with 100 µM of the previously identified substrates dGTP (GE Healthcare, 27-1870-04) for NUDT15 and 8-oxo-dGDP (Jena Bioscience ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by filtration (through 100 μm mesh) and enrichment for leukocytes by gradient centrifugation (40% Percoll GE healthcare, 600 x g, 15 min). To prepare single cell suspensions from spleen tissues ...
-
bioRxiv - Neuroscience 2022Quote: ... blood was diluted 1:1 in PBS and isolated by a Ficoll (GE Healthcare, Fisher Scientific) density gradient separation performed at 800 g for 30 minutes at RT ...
-
bioRxiv - Immunology 2020Quote: ... The sensograms were fit in a 1:1 binding model with BIA Evaluation software (GE Healthcare). For epitope mapping ...
-
bioRxiv - Cell Biology 2021Quote: ... incubated for 1 hour with a secondary antibody anti-Mouse (GE Healthcare, NA9310, 1:5000 dilution), washed three times with TBS-Tween 1 % solution and revealed with an ECL Western blotting detection kit (Advansta ...
-
bioRxiv - Biochemistry 2020Quote: ... HyClone™ DMEM/F-12 (1:1; w/o phenol red) was purchased from GE Healthcare Life Sciences (Logan ...
-
bioRxiv - Microbiology 2024Quote: ... for γ-H2A - anti-rabbit (1:2000 in 1% milk/PBS-T, GE Healthcare, code NA934V); for EF1-α - anti-mouse (1:10,000 in 1% milk/PBS-T ...
-
bioRxiv - Microbiology 2024Quote: ... for EF1-α - anti-mouse (1:10,000 in 1% milk/PBS-T, GE Healthcare, code NA931V). Following secondary incubation ...
-
bioRxiv - Bioengineering 2021Quote: ... pGEX-4T-1 (GE Healthcare, USA), pET-hmCA (9) ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-rabbit (1:5000, GE Healthcare) or anti-rat horseradish peroxidase–conjugated secondary antibodies (1:1000 ...
-
bioRxiv - Biochemistry 2021Quote: ... or pGEX-6P-1 (GE Healthcare) and transformed in One Shot OmniMAX 2 T1R Chemically Competent E ...
-
bioRxiv - Plant Biology 2021Quote: ... or pGEX-4T-1 (GE Healthcare) respectively ...
-
bioRxiv - Biochemistry 2022Quote: ... and pGEX-4T-1 (GE Healthcare) vectors ...
-
bioRxiv - Plant Biology 2022Quote: ... and pGEX-4T-1 (GE healthcare) vectors for prokaryotic expression in E ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1% penicillin–streptomycin (GE Healthcare). For transfection experiments ...
-
bioRxiv - Cell Biology 2021Quote: ... and pGEX-6P-1 (GE Healthcare) vectors ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-rabbit (1:5000, GE Healthcare), or anti-rat horseradish peroxidase–conjugated secondary antibodies (1:1000 ...
-
bioRxiv - Biochemistry 2024Quote: ... GST (1:5,000, GE Healthcare 27457701), HA (1:2,000 ...
-
bioRxiv - Plant Biology 2019Quote: ... and electrotransfered (2 h at 80 V or 16 h at 30 V and 4°C) onto polyvinylidene difluoride membrane (Amersham, GE Healthcare). The recombinant enzymes were probed using anti-V5-HRP conjugated antibody (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... The clarified cell lysates were incubated for 2 h on a spinning wheel at 4°C with 100µl of StrepTactin Sepharose High Performance beads (#28935599, GE Healthcare, USA). Beads were collected by centrifugation (1600 g for 5 min at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... were incubated with GST or GST-tagged angulin-1 cytoplasmic region (409-575 aa or 409-570 aa) for 2-3 h at 4°C and further incubated with Glutathione Sepharose 4B beads (GE Healthcare) for 1 h at 4°C ...
-
bioRxiv - Biochemistry 2020Quote: Proteins (200 μl at 2 μM) were separated on a Superdex 200 Increase 10/300 GL column (GE Healthcare Life Sciences) equilibrated in PBS ...
-
bioRxiv - Molecular Biology 2020Quote: ... Lysed cells were centrifuged 20,000 xg for 30 minutes at 4C and soluble lysate was filtered prior to IMAC purification using 2×5mL His-Trap columns (GE Healthcare) affixed to an Akta Pure ...
-
bioRxiv - Molecular Biology 2021Quote: ... The PAGE gel was exposed to a phosphosimage screen for ∼2 hours and analyzed using a Amersham Typhoon imaging system (GE Healthcare). Band intensities corresponding to the uncleaved ribozymes and the two products of self-scission were analyzed using ImageQuant (GE Healthcare ...
-
bioRxiv - Molecular Biology 2021Quote: ... Then the mixture was centrifuged for 2 mins and the supernatant was desalted by filtration with a Sephacryl S-400 HR column (GE Healthcare), centrifuged at 16 krpm ...
-
bioRxiv - Molecular Biology 2019Quote: ... Stoichiometric amounts of each core histone were incubated together under high salt conditions (2 M NaCl) and the resulting histone octamer purified using a Superdex 200 gel filtration column (GE Healthcare). Purified 147bp DNA carrying the 601 nucleosome-positioning sequence was a kind gift from the Brockdorff lab ...
-
bioRxiv - Bioengineering 2020Quote: ... The ligase was inactivated with 2 M NaCl and the sample was injected into a Sephacryl S-1000 size exclusion column (GE Healthcare) to remove excess oligos and DNA ligase.
-
bioRxiv - Bioengineering 2020Quote: Binding of SARS-CoV-2 RBD to ACE2 –Fc and ACE2mod–Fc fusion proteins were measured using a Biacore T200 instrument (GE Healthcare). Fusion proteins were first immobilized at a coupling density of ∽1000 response units (RU ...
-
bioRxiv - Neuroscience 2020Quote: ... 150 mM NaCl) containing 5% skim milk (Meiji) and subjected to primary antibody for 2 h and HRP-conjugated secondary antibody (GE Healthcare) for 30 min ...
-
bioRxiv - Cell Biology 2021Quote: ... myogenic differentiation was induced by replacing the medium with differentiation medium (DM) consisting of DMEM supplemented with 2% horse serum (GE Healthcare) and PS ...
-
bioRxiv - Biochemistry 2020Quote: ... The cleaved protein was separated from any His6-tagged species by passage through the Ni+2-NTA HisTrap HP column and purified further using size-exclusion chromatography (Superdex S75, GE Healthcare). This also served to exchange the protein in a buffer optimized for NMR experiments (noted below) ...
-
bioRxiv - Cell Biology 2021Quote: ... and 2 mM DTT followed by size exclusion chromatography to remove any protein aggregates using a Superdex 75 column (GE Healthcare) in 25 mM HEPES (pH 7.5) ...
-
bioRxiv - Biophysics 2021Quote: ... Peak fractions were pooled, diluted ~5 fold with buffer 0 (20 mM HEPES, 2 mM DTT) and loaded onto a Q column (GE Healthcare). Rad33 was then eluted from the Q column using a linear gradient of Q buffer A (20 mM HEPES ...
-
bioRxiv - Neuroscience 2022Quote: ... Truncated mouse RANKL transcript (encoding amino acids 137-316 of mouse RANKL) was PCR amplified (forward primer: CACCCCCGGGCAGCGCTTCTCAGGAGCT, reversed primer: GAGACTCGAGTCAGTCTA TGTCCTGAAC) and then cloned into pGEX-5X-2 vector (GE Healthcare) between SmaI and XhoI sites ...
-
bioRxiv - Immunology 2022Quote: The binding kinetics and affinity of recombinant monoclonal antibodies for the SARS-CoV-2 RBD protein (SinoBiological) were analyzed by SPR (Biacore T200, GE Healthcare). Specifically ...
-
bioRxiv - Biophysics 2022Quote: Binding kinetics of ACE2 and SARS-CoV-2 RBDs were determined by surface plasmon resonance using a Biacore S200 (GE Healthcare). All experiments were performed in a running buffer composed of 10 mM HEPES ...
-
bioRxiv - Biochemistry 2022Quote: The binding kinetics of mAbs to SARS-CoV-2 Delta-RBD or Omicron-RBD monomer were analyzed using SPR (Biacore 8K; GE Healthcare). Specifically ...
-
bioRxiv - Biochemistry 2022Quote: ... The supernatant was supplemented with 4 mM CaCl2 and stirred for 2 h in 4°C with CaM-Sepharose beads (GE Healthcare), pre-equilibrated with binding buffer (50 mM Tris/HCl pH 7.2 ...