Labshake search
Citations for GE Life Sciences :
201 - 250 of 274 citations for hsa mir 635 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... and purified by Illustra GFX PCR DNA and a gel band purification kit (GE Healthcare). DNA sequencing was accomplished using 3130xl Genetic Analyzer (Biosystems ...
-
bioRxiv - Plant Biology 2020Quote: ... PCR products were cleaned with the Illustra Sephadex G-50 fine DNA grade column (GE Healthcare) according to the manufacturer’s recommendations and sequenced with a 3730xl Genetic Analyzer (Life Technologies ...
-
bioRxiv - Genetics 2021Quote: ... 10 μl of the PCR reaction was mixed with streptavidin beads (GE Healthcare #17-5113-01) by shaking for 5 minutes at room temperature and ...
-
bioRxiv - Microbiology 2019Quote: ... Approximately 5 μg of PCR products were transformed into the haploid yeast strain BY4741 (GE Healthcare Dharmacon Inc. ...
-
bioRxiv - Molecular Biology 2021Quote: ... The immunoprecipitate was purified using Illustra GFX PCR DNA and Gel Band Purification Kits (GE Healthcare) or QIAquick PCR purification kit (Qiagen ...
-
bioRxiv - Developmental Biology 2021Quote: ... The PCR product was digested and cloned into BamHI restriction sites of pGEX-4T1 (GE Healthcare), pMAL-p5X and p3xFLAG-CMV10 (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2022Quote: ... and illustra™ GFX™ PCR DNA and Gel Band Purification Kit (GE Healthcare Life Sciences) were used ...
-
bioRxiv - Developmental Biology 2020Quote: ... Biotinylated PCR products (20μL) were immobilized on Streptavidin-coated Sepharose beads (GE Healthcare, 17-5113-01). DNA strands were separated using the PyroMark Q24 Vacuum Workstation ...
-
bioRxiv - Zoology 2021Quote: ... One of the obtained PCR products was purified with ExoProStar 1-Step kit (GE Healthcare US77702) and Sanger-sequenced directly at Macrogen (Netherlands) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... PCR products were cleaned with Sephadex G-50 fine medium (70g/L; GE Healthcare, Chicago, Illinois, USA), centrifuged through a 96-well filter plate (Phenix Research ...
-
bioRxiv - Immunology 2019Quote: ... The PCR product was purified with Sera-Mag SpeedBead Carboxylate-Modified Magnetic Particles (GE Healthcare Life Sciences) and after wash with 70% EtOh resuspended in nuclease-free water (Thermo Fisher) ...
-
bioRxiv - Genetics 2020Quote: The amplification reaction was performed in 0.2 ml tube puReTaq Ready-To-GoTM PCR beads (GE Healthcare) containing 2.5 U of lyophilized PuReTaq ...
-
bioRxiv - Microbiology 2021Quote: ... and purified by using an illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare, U.S.A). The linker was generated by annealing 100 μM of each oligonucleotides P2-FW (Table S1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The generated PCR products were pooled and purified using carboxylate-modified magnetic bead solution (GE Healthcare #65152105050250). The purified DNA was used to generate the corresponding RNA by in vitro transcription using HiScribe T7 polymerase (NEB #E2040S) ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were then purified using ExoStar (Illustra™ Exostar™ 1_Step, GE Healthcare Bio-Sciences Corp.). Final PCR products were sent to Macrogen Europe for sequencing using the primers SA (AACCTGGTTGATCCTGCCAGT ...
-
bioRxiv - Microbiology 2020Quote: ... (Frigerio et al., 2020): we used puReTaq Ready-To-Go PCR beads (GE Healthcare Life Sciences, Italy) according to manufacturer’s instructions in a 25 μL reaction ...
-
bioRxiv - Cancer Biology 2022Quote: ... PCR product purification was done with streptavidin-sepharose high-performance beads (GE Healthcare Life Sciences, Piscataway, NJ), and co-denaturation of the biotinylated PCR products and sequencing primer (3.6 pmol/reaction) ...
-
bioRxiv - Cell Biology 2023Quote: ... The PCR plate was sealed with aluminum foil (Mircroplate Foil, 96 well, GE Healthcare, # 28-9758-16) and a temperature gradient of 37°C to 67°C was applied for 3 min using a PCR machine ...
-
bioRxiv - Cell Biology 2023Quote: ... The PCR products were fused in-frame behind GST on a pGex2T vector (GE Healthcare, Buckinghamshire, UK). 6xHis-tagged fragments were amplified from yeast genomic DNA using primers containing SfiI restriction sites ...
-
bioRxiv - Microbiology 2021Quote: ... using appropriate oligonucleotides detailed in Supplementary Table S2 and IllustraTM PuReTaqTM Ready-To-GoTM PCR Beads (GE Healthcare) Negative and positive controls were performed with total RNA or genomic DNA as templates ...
-
bioRxiv - Biochemistry 2022Quote: ... The biotinylated PCR products were purified on a MiniQ 4.6/50 ion exchange column (GE Healthcare Life Sciences) and loaded into a HiTrap Streptavidin HP column (Amersham Biosciences) ...
-
bioRxiv - Microbiology 2019Quote: ... The products of PCR were purified from an agarose gel by using a DNA purification kit (GE Healthcare) and were cloned into the pGEM-T Easy Vector following supplier’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... purified after agarose gel electrophoresis using the GFX™ PCR DNA and Gel Band Purification Kit (GE Healthcare) and ligated into the linearized pHT315-gfp vector ...
-
bioRxiv - Biophysics 2024Quote: The PCR product was purified via ion exchange chromatography using a 5 ml HiTrap Q column (GE Healthcare). The column was equilibrated in Buffer A (25 mM HEPES 7.5 ...
-
bioRxiv - Cell Biology 2019Quote: ... The PCR fragments were cloned in-frame behind GST in the plasmid pGex6P1 or pGex2T (GE Healthcare, Buckinghamshire, UK). For 6xHis-tagged fragments ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and purified using the Illustra GFXTM PCR DNA and Gel Band purification kit (GE Healthcare, Little Chalfont, Buckinghamshire, UK). The purified PCR products were directly sequenced in both directions ...
-
bioRxiv - Microbiology 2022Quote: ... and purified after agarose gel electrophoresis using the GFX™ PCR DNA and Gel Band Purification Kit (GE Healthcare). Insert fragments were amplified with Q5 DNA polymerase (NEB ...
-
bioRxiv - Genetics 2020Quote: ... Radiolabeled probes were prepared by random priming of PCR products covering the regions of interest with Megaprime kit (GE Healthcare) in the presence of α-32P dCTP (3000 Ci/mmol) ...
-
bioRxiv - Biochemistry 2019Quote: ... The template strand was purified by binding the biotinylated PCR product to Streptavidin Sepharose High Performance affinity resin (GE Healthcare), purification of the beads from the reaction mixture by repeated washing with Tris buffer (10 mM Tris HCl pH 7.5 ...
-
bioRxiv - Genetics 2019Quote: ... 20 μg of PCR products was immobilized to 5 μl Streptavidin Sepharose High Performance Bead (GE Healthcare, Piscataway, NJ, USA), and subsequently annealed to 1 μl sequencing primer (5 μM ...
-
bioRxiv - Genomics 2020Quote: ... 20 µl PCR products were subsequently immobilized to 5 µl Streptavidin Sepharose High Performance Bead (GE Healthcare, Piscataway, NJ, USA), and then were finally annealed to 1 µl sequencing primer (5 μM ...
-
bioRxiv - Microbiology 2021Quote: ... The ligated DNA templates were cleaned by an illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare, U.S.A). Finally ...
-
bioRxiv - Plant Biology 2020Quote: ... The coding region of PUB25 was PCR-amplified from previously described pET28a:PUB25 vectors (49) and cloned into bacterial expression vector pMAL-c2x (GE Healthcare) by digestion and ligation cloning using XbaI and PstI-HF (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... Digestion products were purified with the illustra GFX PCR DNA and gel band purification kit (GE Healthcare, Little Chalfont, UK) and were directionally cloned in the yeast expression vector pYES2 (Invitrogen ...
-
bioRxiv - Genetics 2019Quote: ... PCR amplicons from each species presenting positive signals for Micropia were separated by 1.5% agarose gel electrophoresis and purified using Illustra GFXTM PCR DNA and Gel Band Purification kit (GE Healthcare) according to the supplier’s specifications ...
-
bioRxiv - Biochemistry 2024Quote: ... The amplified PCR product was digested with BamHI and XhoI and ligated into the vector PGEx-6p-1 (GE Healthcare) digested with the same restriction enzymes ...
-
bioRxiv - Cell Biology 2020Quote: ... the BglII–SalI fragment of HA-Catalase amplified by PCR from pUcD3/HA-HsCatalase (Otera and Fujiki, 2012) was cloned into the BamHI–SalI sites of pGEX6P-1 (GE Healthcare), thereby generating pGEX/HA-HsCatalase ...
-
bioRxiv - Cell Biology 2019Quote: ... The PCR product was purified and digested with BamH1 and SalI and cloned into in the pGEX-6P-1 vector (GE Healthcare) to generate GST-BRCA2190-283 ...
-
bioRxiv - Microbiology 2019Quote: ... Plasmid pGEX-dosR expressing DosR with an N-terminal GST-tag was generated by cloning PCR-derived dosR ORF fragment between BamHI and XhoI sites of pGEX 4T-1 (GE Healthcare) as described for pGEX-phoP (49) ...
-
bioRxiv - Plant Biology 2020Quote: ... The solution was neutralized by adding 1 M HCl and the cDNA was purified with the illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare). The 5’-3’ junction sequence was amplified by PCR with cox1 specific primers Atcox1-5’(−176..-196 ...
-
bioRxiv - Evolutionary Biology 2021Quote: PCR products of the expected size (359 bp) yielding ≥ 20 ng were cleaned using ExoSAP-IT PCR Clean-up Kits (GE Healthcare). In cases where the yield of PCR products was lower than this threshold ...
-
bioRxiv - Cell Biology 2020Quote: Yeast Cka1 and Tda1 genes were amplified by PCR from yeast genomic DNA and then cloned into pGEX4T-1 (GE healthcare) vector ...
-
bioRxiv - Plant Biology 2022Quote: ... The PCR product was cloned downstream and in frame with the glutathione S-transferase (GST) ORF in pGEX-3X (GE Healthcare). The expression construct was transfected into E ...
-
bioRxiv - Evolutionary Biology 2022Quote: Recombinant pGEM-T easy vectors used to sequence the lncov1 full-length were digested with EcoRI (Fermentas) and purified again with the Illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare). In vitro reverse transcription was performed using the RiboMax T7 system (Promega ...
-
bioRxiv - Developmental Biology 2020Quote: ... cDNA encoding full-length dMed19 and deletion derivatives were amplified by PCR using appropriated oligonucleotides and inserted into the BamHI/NotI site of the pGEX-6P1 vector (GE Healthcare). Pnr aa 1-291 fragment-encoding was amplified by PCR and cloned into pcDNA3 vector ...
-
bioRxiv - Microbiology 2019Quote: ... DNA was excised from the gels and extracted using the Illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Radiolabeled probes were typically generated by random priming of PCR products covering the regions of interest with Megaprime kit (GE Healthcare) in the presence of α-32P dCTP (3000 Ci/mmol) ...
-
bioRxiv - Biochemistry 2021Quote: ... a PCR fragment containing ubiquitin gene and a PCR fragment containing rat parkin residues 77-465 were introduced into the BamHI/XhoI sites of pGEX-6P1 (GE Healthcare). The serine (S77 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The PCR product was transcribed in vitro using T7 RNA-polymerase and purified by a Hitrap Q HP column (GE Healthcare) with ethanol precipitation.
-
bioRxiv - Cell Biology 2020Quote: ... A probe was generated from a PCR fragment homologous to the 3’ sequence just outside of the targeted region using the AlkPhos direct labelling kit (GE Healthcare) according to manufacturer’s instructions ...