Labshake search
Citations for GE Life Sciences :
1951 - 2000 of 4014 citations for Monocyclohexyl Phthalate 100 Ug Ml In Mtbe Ring 1 2 13C2 Dicarboxyl 13C2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... purified RNA was electrophoresed in non-denaturing 2% agarose TBE gel and then gel was blotted onto an Hybound-N nylon membrane (RPN303N, GE Healthcare) by semidry electroblotting in 0.5× TBE buffer for 2 hours at 200mA ...
-
bioRxiv - Biophysics 2021Quote: ... Peak fractions were pooled, diluted ~5 fold with buffer 0 (20 mM HEPES, 2 mM DTT) and loaded onto a Q column (GE Healthcare). Rad33 was then eluted from the Q column using a linear gradient of Q buffer A (20 mM HEPES ...
-
bioRxiv - Neuroscience 2022Quote: ... Truncated mouse RANKL transcript (encoding amino acids 137-316 of mouse RANKL) was PCR amplified (forward primer: CACCCCCGGGCAGCGCTTCTCAGGAGCT, reversed primer: GAGACTCGAGTCAGTCTA TGTCCTGAAC) and then cloned into pGEX-5X-2 vector (GE Healthcare) between SmaI and XhoI sites ...
-
bioRxiv - Immunology 2022Quote: The binding kinetics and affinity of recombinant monoclonal antibodies for the SARS-CoV-2 RBD protein (SinoBiological) were analyzed by SPR (Biacore T200, GE Healthcare). Specifically ...
-
bioRxiv - Biophysics 2022Quote: Binding kinetics of ACE2 and SARS-CoV-2 RBDs were determined by surface plasmon resonance using a Biacore S200 (GE Healthcare). All experiments were performed in a running buffer composed of 10 mM HEPES ...
-
bioRxiv - Biochemistry 2022Quote: The binding kinetics of mAbs to SARS-CoV-2 Delta-RBD or Omicron-RBD monomer were analyzed using SPR (Biacore 8K; GE Healthcare). Specifically ...
-
bioRxiv - Biochemistry 2022Quote: ... The supernatant was supplemented with 4 mM CaCl2 and stirred for 2 h in 4°C with CaM-Sepharose beads (GE Healthcare), pre-equilibrated with binding buffer (50 mM Tris/HCl pH 7.2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... the gel was washed with the wash buffer and the IF3-bound complexes were eluted by additional incubation of 2 h with the PreScission protease (GE Healthcare) (2 U/μl).
-
bioRxiv - Immunology 2022Quote: SPR screening and affinity measurements of monoclonal Fabs binding to SARS-CoV-2 spike proteins were performed using a Biacore S200 instrument (Cytiva, formerly GE Healthcare) in HBS-EP+ 1X running buffer ...
-
bioRxiv - Biochemistry 2022Quote: Antibody binding to SARS-CoV-2 spike was assessed using SPR on a Biacore T-200 (Cytiva, MA, formerly GE Healthcare) with HBS buffer supplemented with 3 mM EDTA and 0.05% surfactant P-20 (HBS-EP+ ...
-
bioRxiv - Neuroscience 2020Quote: T1-weighted images providing high anatomical detail were acquired on 2 GE 3T Discovery 750× scanners (GE Healthcare, Waukesha, WI, USA) with an 8-channel phased array head coil (scanner 1 N=336 ...
-
bioRxiv - Microbiology 2020Quote: ... Aliquots were taken every 30 minutes for a period of 2 hours and quenched in 3ml of 5% trichloroacetic acid (TCA) on Whatman-glass fiber filters (GE healthcare) and washed 3 times with 1ml ethanol to dry the filter ...
-
bioRxiv - Neuroscience 2020Quote: Dynamic PET/CT imaging (2-3h) with arterial blood sampling was performed on Monkey 3 and Monkey 4 using a Discovery MI (GE Healthcare). Each animal had two baseline scans which were separated by one month for Monkey 3 and by one year for Monkey 4 ...
-
bioRxiv - Molecular Biology 2019Quote: ... (amino acids 2-241 fused to 6 x his) were expressed in BL21 cells and purified on glutathione-linked sepharose beads (GE healthcare) or Ni-NTA-Agarose (GE healthcare ...
-
bioRxiv - Microbiology 2021Quote: ... Gels were dried and exposed on a phosphoscreen for 2-4 days and visualized using a Typhoon Imaging System (GE Healthcare). Bands were quantified using band densitometry using the ImageQuant software (GE Healthcare).
-
bioRxiv - Biochemistry 2021Quote: The binding affinities of full IgG antibodies to SARS-CoV-2 spike protein were determined using surface plasmon resonance (SPR) and a BIAcore T200 instrument (GE Healthcare) at 25°C ...
-
bioRxiv - Zoology 2019Quote: The midgut BBMV proteins were subjected to clean-up using the 2-D Clean-up Kit (GE Healthcare Life Sciences, USA) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... cDNAs coding for HSC70 and HSC70-SBD were cloned in BamHI and XhoI sites of pGEX-5X-2 bacterial expression vector (GE Healthcare). Sequences of all the mutants were confirmed by automated DNA sequencing.
-
bioRxiv - Biophysics 2019Quote: ... The eluted Sox2 and Oct4 were refolded by dialyzing to 2 M urea and then to 0 urea using a desalting column (GE healthcare). Further purification was carried out by gel filtration using a Superdex 200 10/300 GL column (GE Healthcare) ...
-
bioRxiv - Cell Biology 2019Quote: ... phenolics and nucleic acids in extracted protein were removed using the 2-D Clean-Up kit (GE Healthcare, Piscataway, NJ, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... TolA was loaded into the cell and synthetic TolB peptide (residues 22-33; 2 mM) loaded into the syringe of an iTC200 microcalorimeter (Microcal/GE Healthcare). Titration consisted of 20 injections (1 x 0.4 μl ...
-
bioRxiv - Microbiology 2020Quote: ... PCR amplified fragments of the NP(412-500) or shorter fragments from pCAGGS-NP were cloned into pGEX-6P-2 (GE Healthcare). All sequences of the cloned or mutated DNA regions of the plasmids were validated by Sanger DNA sequencing.
-
bioRxiv - Immunology 2021Quote: One mg per sample of mouse anti-H-2 Kb/Db antibody (ATCC HB-51) was bound and cross-linked to Protein A beads (GE healthcare) using dimethyl pimelimidate (DMP ...
-
bioRxiv - Physiology 2020Quote: ... and incubated lysate equivalent to 2 mg of protein with 50 μL Streptavidin Sepharose High-Performance beads (GE Healthcare, IL, USA) for 2 h at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 3D widefield datasets were acquired using a 100x 1.4NA Uplan S Apochromat objective on a DeltaVision 2 Ultra microscope equipped with 7-Color SSI module and sCMOS camera and controlled by Acquire Ultra acquisition software (GE Healthcare), computationally deconvolved using the enhanced ratio constrained iterative deconvolution algorithm ...
-
bioRxiv - Microbiology 2020Quote: ... fluorescently labeled R18-HRSV or culture supernatants of HEp-2 were separated from excess R18 by a separation column (PD-10 Desalting Columns GE Healthcare). HRSV-R18 or culture supernatants of HEp-2 were incubated in suspension with A3.01 and HEp-2 cells at 4°C for 1 h to allow virus attachment ...
-
bioRxiv - Molecular Biology 2021Quote: ... The amplified products were separated by electrophoresis on a 2% agarose gel and quantified by using Image Quant TL analysis software (GE Healthcare). Quantitative real-time PCR was performed on a TP-850 Real-Time PCR Detection System (TAKARA Bio ...
-
bioRxiv - Molecular Biology 2021Quote: ... Full-length nsp1 was synthesized as a gene fragment from Integrated DNA technologies (IDT) and cloned into the EcoR1 restriction site of pGEX-6P-2 (GE healthcare) using in-fusion cloning (TakaraBio) ...
-
bioRxiv - Immunology 2020Quote: ... An equal volume of buffer (2 mM EDTA in PBS) and blood was mixed and carefully layered over 5ml Ficoll Hypaque solution (GE Healthcare). After centrifugation for 20 min at 900 g (with no break ...
-
bioRxiv - Immunology 2021Quote: The binding affinities of antibodies to SARS-CoV-2 spike protein were determined using surface plasmon resonance (SPR) and a BIAcore T200 instrument (GE Healthcare) at 25°C ...
-
bioRxiv - Immunology 2021Quote: ... and ACE2(HH:NN)-Fc constructs were captured on flow cell 2 of a Series S Protein A sensor chip (GE Healthcare – 29127555) to a density of 500 RU using a Biacore 8K instrument (GE Healthcare) ...
-
bioRxiv - Cell Biology 2020Quote: ... and differentiation was induced in differentiation medium (DM) for hMB consisting of DMEM (Nacalai) with 2% horse serum (HS) (HyClone; GE Healthcare) and PS.
-
bioRxiv - Cancer Biology 2022Quote: ... were resuspended in 500 μl IP buffer and incubated with the appropriate antibodies on ice for 2 h and then 30 μl protein-G-sepharose beads (GE Healthcare; equilibrated once in 10 ml water and three times in washing buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... secondary antibodies were incubated for 2 h at room temperature and visualized on X-ray films using enhanced chemiluminescence detection kit (GE Healthcare).
-
bioRxiv - Immunology 2022Quote: ... The ACE2 receptor or SARS-CoV-2 spike-specific antibodies (CR3022 or S309) were immobilized on the protein A sensor chip (GE Healthcare) at a ligand capture level of ∼100 RU ...
-
bioRxiv - Biochemistry 2023Quote: ... and 2 mM DTT) for 16 h before further purification by anion exchange chromatography on a HiTrap Q HP column (GE Healthcare), followed by size exclusion chromatography (SEC ...
-
bioRxiv - Neuroscience 2023Quote: ... lysates were incubated with the primary antibody at 4°C for 2 h or overnight and then incubated with protein G- or protein A-Sepharose (GE Healthcare) for 2 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... On day 2, cells were changed with fresh media containing RMPI1640 (Thermo, 21870) supplemented with 0.2% Hyclone FBS (GE Healthcare, SH30070.03) 100 ng/mL Activin A (R&D Systems ...
-
bioRxiv - Microbiology 2023Quote: ... F045 and TriHSB.2 constructs contain C-terminal 6xHis tags and were purified by passage over a HisTrapFF column (GE Healthcare), followed by size exclusion chromatography using a Superdex 200 increase 10/300 column (Cytiva) ...
-
bioRxiv - Cell Biology 2023Quote: ... Finally membranes were again washed three times with TBST and submerged in SuperSignal West Pico chemiluminescent substrate for 2 min before visualizing through ImageQuant LAS 4000 chemiluminescent Image analyzer (GE Healthcare). We used a variety of inhibitors including Torin 1 (inh-tor1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The membranes were then incubated for 2-h at room temperature with rabbit HRP-linked IgG (GE Healthcare, Chicago, IL, USA), and a chemiluminescence detection reagent (SuperSignal™ West Pico PLUS Chemiluminescent Substrate ...
-
bioRxiv - Neuroscience 2023Quote: ... The PAGE gel was exposed to a phosphorimage screen for ∼2 hours and analyzed using a Typhoon imaging system (GE Healthcare). Band intensities corresponding to the uncleaved ribozymes and the two products of self-scission were analyzed using ImageQuant (GE Healthcare ...
-
bioRxiv - Neuroscience 2022Quote: ... The blots were visualised with the BioRad ChemiDoc XRS+ (Cohort 2) or the Amersham 6000 Gel Imager (GE Healthcare, Cohort 3), and quantified with Image Lab Software (BioRad) ...
-
bioRxiv - Biophysics 2022Quote: ... TCA extracts of total yeast or 2 μg of mitochondrial proteins were loaded on a 12 % SDS-PAGE and transferred onto a nitrocellulose membrane (GE Healthcare). UCP1 was detected using a mouse anti-pentahistidine tag:HRP 0.2 μL/mL (MCA5995P – Bio-RAD) ...
-
bioRxiv - Genetics 2023Quote: ... (2) 75 µl blood to prepare Dried Blood Spots (DBS, Whatman® 903 generic multipart filter paper, GE Healthcare, Westborough, USA) for metabolic profiling ...
-
bioRxiv - Neuroscience 2023Quote: ... 100 µl of 100% ethanol or 10% DEET in ethanol was applied to a 2 cm x 6 cm strip of Whatman filter paper (GE Healthcare). The treated paper was hung from a rectangular plastic frame in front of the Peltier element ...
-
bioRxiv - Immunology 2023Quote: The binding kinetics and affinity of monoclonal antibodies to the SARS-CoV-2 spike trimer were analyzed by SPR (Biacore T100, GE Healthcare). Specifically ...
-
bioRxiv - Biophysics 2023Quote: ... Eluted protein was digested with Ulp1 protease at 4°C for 2 h and then further purified on a Heparin HP column (GE Healthcare), eluting with a linear gradient of increasing NaCl concentration from 300 mM to 1 M in 20 mM Tris-HCl ...
-
bioRxiv - Biophysics 2023Quote: ... Eluted protein was digested with Ulp1 protease at 4°C for 2 h and then further purified on a Heparin HP column (GE Healthcare), eluting with buffer containing 20 mM Tris-HCl ...
-
bioRxiv - Biophysics 2024Quote: ... Samples were run for 2 h at 90 V and then scanned using a Typhoon FLA 9500 laser scanner (GE Healthcare) at a pixel size of 50 µm ...