Labshake search
Citations for GE Life Sciences :
1901 - 1950 of 2051 citations for 6 Iodo quinazoline 2 4 diamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... The PAGE gel was exposed to a phosphosimage screen for ∼2 hours and analyzed using a Amersham Typhoon imaging system (GE Healthcare). Band intensities corresponding to the uncleaved ribozymes and the two products of self-scission were analyzed using ImageQuant (GE Healthcare ...
-
bioRxiv - Molecular Biology 2021Quote: ... Then the mixture was centrifuged for 2 mins and the supernatant was desalted by filtration with a Sephacryl S-400 HR column (GE Healthcare), centrifuged at 16 krpm ...
-
bioRxiv - Biochemistry 2019Quote: ... analytical gel size-exclusion chromatography was performed with 1-2 mg protein in buffer A on a Superdex 75 10/300 column (GE Healthcare), to which a static light-scattering (SLS ...
-
bioRxiv - Developmental Biology 2019Quote: ... A total of 96 fractions were collected in a row-wise snaking pattern into a Whatman 2 ml 96-well plate (GE Healthcare), which were then concatenated non-sequentially into a final 24 fractions for proteomic analysis ...
-
bioRxiv - Biochemistry 2019Quote: ... Protein was loaded at concentrations ranging from 2 to 16 mg/ml on a Superdex 200 10/300 GL column (GE Healthcare) equilibrated in 20 mM HEPES ...
-
bioRxiv - Biochemistry 2020Quote: ... and 2 mM DTT for 1 hour prior to purification on a Superdex 200 10/300 size-exclusion column (GE Healthcare). Rac1 (G12V ...
-
bioRxiv - Biochemistry 2019Quote: ... A 50-μl protein sample (1-2 mg/ml) was analyzed on a Superdex S-200 10/300 GL column (GE Healthcare) pre-equilibrated with a buffer containing 20 mM Tris-HCl (pH 8.0) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Stoichiometric amounts of each core histone were incubated together under high salt conditions (2 M NaCl) and the resulting histone octamer purified using a Superdex 200 gel filtration column (GE Healthcare). Purified 147bp DNA carrying the 601 nucleosome-positioning sequence was a kind gift from the Brockdorff lab ...
-
bioRxiv - Biochemistry 2019Quote: ... the purified sample was concentrated to 2 mL and loaded onto a HiPrep 16/60 Sephacryl S-300 HR column (GE Healthcare) equilibrated and run in Sizing Buffer (50 mM HEPES pH 7.5 ...
-
bioRxiv - Biophysics 2021Quote: ... After dialysis the histones in 2 M NaCl were concentrated to a volume of 1 mL and purified using an Superdex 200 column (GE Healthcare) on an FPLC (Agilent) ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins were concentrated to 2 mL and further purified by size-exclusion chromatography using HiLoad 16/600 Superdex 200 (Ge healthcare).
-
bioRxiv - Biochemistry 2021Quote: ... The purified protein was then concentrated to 2 mL and purified by FPLC sizeexclusion chromatography using a Superdex 75 10/300 GL (GE Healthcare) column into 20 mM NaPO4 150 mM NaCl pH 7.5 ...
-
bioRxiv - Bioengineering 2020Quote: ... The ligase was inactivated with 2 M NaCl and the sample was injected into a Sephacryl S-1000 size exclusion column (GE Healthcare) to remove excess oligos and DNA ligase.
-
bioRxiv - Bioengineering 2020Quote: Binding of SARS-CoV-2 RBD to ACE2 –Fc and ACE2mod–Fc fusion proteins were measured using a Biacore T200 instrument (GE Healthcare). Fusion proteins were first immobilized at a coupling density of ∽1000 response units (RU ...
-
bioRxiv - Biochemistry 2021Quote: 50 μl of the N protein samples (1 mg/ml) purified according to protocols 1 or 2 were loaded onto a Superdex 200 Increase 10/300 column (GE Healthcare) pre-equilibrated with 20 mM HEPES ...
-
bioRxiv - Neuroscience 2020Quote: ... 150 mM NaCl) containing 5% skim milk (Meiji) and subjected to primary antibody for 2 h and HRP-conjugated secondary antibody (GE Healthcare) for 30 min ...
-
bioRxiv - Biophysics 2021Quote: ... The flow through containing SARS-CoV-2 Mpro was collected and further purified using size exclusion chromatography column (G-100, GE Healthcare,) equilibrated with 20 mM Tris ...
-
bioRxiv - Cell Biology 2021Quote: ... myogenic differentiation was induced by replacing the medium with differentiation medium (DM) consisting of DMEM supplemented with 2% horse serum (GE Healthcare) and PS ...
-
bioRxiv - Biochemistry 2020Quote: ... The cleaved protein was separated from any His6-tagged species by passage through the Ni+2-NTA HisTrap HP column and purified further using size-exclusion chromatography (Superdex S75, GE Healthcare). This also served to exchange the protein in a buffer optimized for NMR experiments (noted below) ...
-
bioRxiv - Cell Biology 2021Quote: ... The mass evaluated using UV as concentration source was 55.7 kDa for the 2 mg/ml sample.The Odinarchaeota samples were analysed by SEC-MALS (100 μl protein complex at 2 mg/ml) were passed over a Superdex 200 10/300 Increase GL column (GE Healthcare), in 20 mM Tris (pH 8.0) ...
-
bioRxiv - Cell Biology 2021Quote: ... and 2 mM DTT followed by size exclusion chromatography to remove any protein aggregates using a Superdex 75 column (GE Healthcare) in 25 mM HEPES (pH 7.5) ...
-
bioRxiv - Cancer Biology 2020Quote: ... purified RNA was electrophoresed in non-denaturing 2% agarose TBE gel and then gel was blotted onto an Hybound-N nylon membrane (RPN303N, GE Healthcare) by semidry electroblotting in 0.5× TBE buffer for 2 hours at 200mA ...
-
bioRxiv - Biophysics 2021Quote: ... 100-μl protein samples (at approximately 2 mg/ml) were loaded onto a Superdex 200 or 75 10/300 GL Increase size-exclusion chromatography column (GE Healthcare) in 20 mM Tris HCl ...
-
bioRxiv - Biophysics 2020Quote: ... followed by 2 CV of 100% IEX buffer B using an ÄKTA Pure fast protein liquid chromatography (FPLC) system (GE Healthcare). To determine the point of elution of aSyn from the chromatography column protein fractions which were collected and monitored on absorption at 280 nm were ran on a 4-12% Bis-Tris gel (Invitrogen ...
-
bioRxiv - Biophysics 2021Quote: ... Peak fractions were pooled, diluted ~5 fold with buffer 0 (20 mM HEPES, 2 mM DTT) and loaded onto a Q column (GE Healthcare). Rad33 was then eluted from the Q column using a linear gradient of Q buffer A (20 mM HEPES ...
-
bioRxiv - Neuroscience 2022Quote: ... Truncated mouse RANKL transcript (encoding amino acids 137-316 of mouse RANKL) was PCR amplified (forward primer: CACCCCCGGGCAGCGCTTCTCAGGAGCT, reversed primer: GAGACTCGAGTCAGTCTA TGTCCTGAAC) and then cloned into pGEX-5X-2 vector (GE Healthcare) between SmaI and XhoI sites ...
-
bioRxiv - Immunology 2022Quote: The binding kinetics and affinity of recombinant monoclonal antibodies for the SARS-CoV-2 RBD protein (SinoBiological) were analyzed by SPR (Biacore T200, GE Healthcare). Specifically ...
-
bioRxiv - Biophysics 2022Quote: Binding kinetics of ACE2 and SARS-CoV-2 RBDs were determined by surface plasmon resonance using a Biacore S200 (GE Healthcare). All experiments were performed in a running buffer composed of 10 mM HEPES ...
-
bioRxiv - Biochemistry 2022Quote: The binding kinetics of mAbs to SARS-CoV-2 Delta-RBD or Omicron-RBD monomer were analyzed using SPR (Biacore 8K; GE Healthcare). Specifically ...
-
bioRxiv - Biophysics 2022Quote: ... Peak fractions were diluted with 2 volumes of buffer H and loaded onto a 1-mL SP HP column (GE Healthcare) and washed with buffer C (50 mM HEPES pH 7.5 ...
-
bioRxiv - Molecular Biology 2022Quote: ... the gel was washed with the wash buffer and the IF3-bound complexes were eluted by additional incubation of 2 h with the PreScission protease (GE Healthcare) (2 U/μl).
-
bioRxiv - Microbiology 2022Quote: ... or His-NTV-AviTag (80 µl at 2 mg/ml) were injected on a Superdex 200 increase 10/300 GL column (GE Healthcare), equilibrated at 4°C with a buffer containing 25 mM HEPES pH 7.5 ...
-
bioRxiv - Plant Biology 2022Quote: ... The obtained pellet was resuspended in 2 mL of washing buffer and loaded on top of a 28% (v/v) Percoll (GE Healthcare) continuous gradient with a 0% to 4% (w/v ...
-
bioRxiv - Immunology 2022Quote: SPR screening and affinity measurements of monoclonal Fabs binding to SARS-CoV-2 spike proteins were performed using a Biacore S200 instrument (Cytiva, formerly GE Healthcare) in HBS-EP+ 1X running buffer ...
-
bioRxiv - Biochemistry 2022Quote: Antibody binding to SARS-CoV-2 spike was assessed using SPR on a Biacore T-200 (Cytiva, MA, formerly GE Healthcare) with HBS buffer supplemented with 3 mM EDTA and 0.05% surfactant P-20 (HBS-EP+ ...
-
bioRxiv - Neuroscience 2020Quote: T1-weighted images providing high anatomical detail were acquired on 2 GE 3T Discovery 750× scanners (GE Healthcare, Waukesha, WI, USA) with an 8-channel phased array head coil (scanner 1 N=336 ...
-
bioRxiv - Microbiology 2020Quote: ... Aliquots were taken every 30 minutes for a period of 2 hours and quenched in 3ml of 5% trichloroacetic acid (TCA) on Whatman-glass fiber filters (GE healthcare) and washed 3 times with 1ml ethanol to dry the filter ...
-
bioRxiv - Biochemistry 2021Quote: The binding affinities of full IgG antibodies to SARS-CoV-2 spike protein were determined using surface plasmon resonance (SPR) and a BIAcore T200 instrument (GE Healthcare) at 25°C ...
-
bioRxiv - Bioengineering 2020Quote: ... 100 μl of freshly purified protein (concentration 1-2 mg/ml) was injected on a Superdex 75 300/10 GL column (GE Healthcare) at a flow rate of 0.5 ml/min ...
-
bioRxiv - Immunology 2022Quote: ... mononuclear cells were isolated by density gradient centrifugation of PBS-diluted buffy coat/blood (1:2) over Ficoll-Paque Plus (GE Healthcare). The PBMC layer was carefully removed and washed 3 times with PBS.
-
bioRxiv - Cancer Biology 2022Quote: ... Blood was diluted 1:2 with 1× phosphate-buffered saline (PBS) and transferred to a 50 ml falcon tube with Ficoll-Paque PLUS (GE Healthcare) at a 1:2 ratio ...
-
Phosphorylation of the Smooth Muscle Master Splicing Regulator RBPMS Regulates its Splicing ActivitybioRxiv - Molecular Biology 2022Quote: ... 50-μl protein samples (at approximately 2 mg/ml) were loaded onto a Superdex 75 10/300 GL increase size-exclusion chromatography column (GE Healthcare) in 10 mM HEPES ...
-
bioRxiv - Zoology 2019Quote: The midgut BBMV proteins were subjected to clean-up using the 2-D Clean-up Kit (GE Healthcare Life Sciences, USA) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... cDNAs coding for HSC70 and HSC70-SBD were cloned in BamHI and XhoI sites of pGEX-5X-2 bacterial expression vector (GE Healthcare). Sequences of all the mutants were confirmed by automated DNA sequencing.
-
bioRxiv - Biophysics 2019Quote: ... The eluted Sox2 and Oct4 were refolded by dialyzing to 2 M urea and then to 0 urea using a desalting column (GE healthcare). Further purification was carried out by gel filtration using a Superdex 200 10/300 GL column (GE Healthcare) ...
-
bioRxiv - Cell Biology 2019Quote: ... phenolics and nucleic acids in extracted protein were removed using the 2-D Clean-Up kit (GE Healthcare, Piscataway, NJ, USA) according to the manufacturer’s instructions ...
-
Bridging of nucleosome-proximal DNA double-strand breaks by PARP2 enhances its interaction with HPF1bioRxiv - Biochemistry 2019Quote: ... diluted by half to lower NaCl concentration to 250 mM and applied at 2 mL/min onto a HiTrap Heparin HP 5 mL column (GE Healthcare) previously equilibrated in Tris 50 mM ...
-
bioRxiv - Biophysics 2019Quote: ... The reaction was incubated at 37°C for 2-3 hours on an orbital shaker and loaded onto an anion-exchange colum (1 ml DEAE FF, GE Healthcare) equilibrated in 50 mM Tris-HCl pH 7.4 ...
-
bioRxiv - Microbiology 2020Quote: ... M was concentrated to 2 ml using Vivaspin20 columns (SartoriusStedimBiotec) and purified on a HiLoad 10/600 Superdex S200 column (GE Healthcare) in 50 mM NaH2PO4-Na2HPO4 ...
-
bioRxiv - Cell Biology 2019Quote: ... the primary antibody was visualized using 2~5 μg/ml secondary antibody towards specific species of primary antibody labeled with Cy3B (GE Healthcare) or Atto 488 (Sigma-Aldrich ...