Labshake search
Citations for GE Life Sciences :
1401 - 1450 of 2640 citations for Oxytocin Chemiluminescent ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... as capture molecule to the dextran surface of both flow cells of a CM5 Chip (GE Heathcare) using an amine coupling kit (GE healthcare). GST tagged ligand proteins were captured on the detection flow cell of the chip and free GST was captured on the reference flow cell ...
-
bioRxiv - Microbiology 2020Quote: ... blocked for 1 hour and immuno-detected using Anti-RecA (E. coli) antibody (1000x dilution) (gift from Mike Cox, (52)) and analyzed using an ECL Prime detection kit (GE Healthcare). Densitometry was performed using ImageJ (https://imagej.nih.gov/ij/)
-
bioRxiv - Microbiology 2021Quote: ... between 400 to 600 RU of biotinylated anti-IFX monoclonal antibodies were immobilised on a streptavidin-coated sensor chip prepared using the Biotin CAPture kit (GE Healthcare); a biotinylated mouse monoclonal antibody (OX68 ...
-
bioRxiv - Microbiology 2019Quote: ... DNA was excised from the gels and extracted using the Illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Radiolabeled probes were typically generated by random priming of PCR products covering the regions of interest with Megaprime kit (GE Healthcare) in the presence of α-32P dCTP (3000 Ci/mmol) ...
-
bioRxiv - Genomics 2021Quote: Genomic DNA was extracted from rosette leaves of one individual plant using the Nucleon Phytopure genomic DNA extraction kit (GE Healthcare), and whole genome bisulfite sequencing (WGBS ...
-
bioRxiv - Cell Biology 2020Quote: ... A probe was generated from a PCR fragment homologous to the 3’ sequence just outside of the targeted region using the AlkPhos direct labelling kit (GE Healthcare) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... membranes were washed and revealed using a commercial kit (Pierce ECL Western Blotting Substrate, Thermo Fischer) and photos were taken by the ImageQuant LAS 4000 mini (GE Healthcare) camera system ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... DNA was extracted from each sample along with the RNA as per manufacturer instructions and amplified using a whole genome amplification kit (illustra GenomePhi v2, GE Healthcare). Sex-specific primers (Table S1 ...
-
bioRxiv - Microbiology 2021Quote: ... All blots were washed 4X with PBS-T and then developed with a Amersham ECL Western Blotting Detection Kit (GE Healthcare).
-
bioRxiv - Biochemistry 2022Quote: ... secondary antibodies were incubated for 2 h at room temperature and visualized on X-ray films using enhanced chemiluminescence detection kit (GE Healthcare).
-
bioRxiv - Plant Biology 2022Quote: ... of leaf tissues from M15 plants grown outside under low light conditions using the illustra Nucleon Phytopure Genomic DNA Extraction Kit (GE Healthcare) after grinding the leaves in liquid nitrogen to a fine powder ...
-
bioRxiv - Microbiology 2023Quote: ... Southern blotting to confirm the genotypes were performed using ECL™ Direct Nucleic Acid Labeling and Detection kit (GE Healthcare, USA). Probe (650 bp ...
-
bioRxiv - Molecular Biology 2023Quote: ... These primary antibodies were detected using HRP conjugated anti-mouse and anti-rabbit IgGs and the ECL detection kit (all from GE Healthcare). Band intensities were quantified by densitometric analysis with Image Lab software (Bio-Rad).
-
bioRxiv - Molecular Biology 2022Quote: ... the membrane was hybridized with a random-primed 32P-labeled specific probe using Amersham™ Megaprime kit (GE Healthcare, Cat# RPN1607). The probe was obtained from a 1.45 kb PCR product (primers list in Table S3 ...
-
bioRxiv - Plant Biology 2024Quote: ... Immunodetection was performed using an ECL Plus Western Detection Kit and revealed with an ImageQuant LAS 4000 mini CCD camera system (GE Healthcare). ImageJ was used for quantifications of the bands.
-
bioRxiv - Neuroscience 2024Quote: ... RNA (5 μg) was used to synthesize the first-strand complementary DNA (cDNA) using the First-Strand cDNA synthesis kit (GE Healthcare) with a pd(N)6 primer following the manufacturer’s indications ...
-
bioRxiv - Molecular Biology 2022Quote: The samples were purified using a minicolumns GFX PCR DNA & gel band purification kit (GE Healthcare Bio-Sciences AB Uppsala, Sweden) according to a previously described protocol (https://dx.doi.org/10.17504/protocols.io.brzpm75n) ...
-
bioRxiv - Molecular Biology 2022Quote: ... the PCR amplified eleven positive virus genomes were amplified by RCA (rolling circle amplification) using the RCA-based TempliPhi DNA amplification kit (GE Healthcare) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5% dextran sulfate) at 65°C probed with 32P-labeled CLB3 DNA probes prepared via Amersham Megaprime DNA labeling kit (GE Healthcare) and Illustra ProbeQuant columns (GE Healthcare) ...
-
bioRxiv - Cell Biology 2023Quote: Gel-purified PCR products were used to generate radio-labeled probes to detect CLN2 and ACT1 mRNAs by Northern blotting (oligonucleotides: TCAAGTTGGATGCAATTTGCAG, TGAACCAATGATCAATGATTACGT; ACT1 oligonucleotides: TCATACCTTCTACAACGA-ATTGAGA and ACACTTCATGATGGAGTTGTAAGT. Probes were labeled using the Megaprime DNA labelling kits (GE Healthcare). Northern blotting was carried out as previously described (Cross and Tinkelenberg ...
-
bioRxiv - Plant Biology 2023Quote: ... DNA was isolated from leaf tissue of 4-wk-old plants by using Illustra Nucleon Phytopure extraction kit reagents (GE Healthcare). DNA was isolated from agarose gel pieces using QIAquick gel extraction kit (Qiagen).
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCR products amplified with primers Aeatro-Nix-F1/R1 were purified with GFX PCR DNA and Gel Band Purification Kit (GE Healthcare) and cloned into pJET1.2/blunt cloning vector ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCR products amplified with primers Aeatro-Nix-F2/R2 were purified with GFX PCR DNA and Gel Band Purification Kit (GE Healthcare) and directly sequenced.
-
bioRxiv - Biochemistry 2022Quote: ... The antibodies were captured on a CM5 chip immobilized with anti-human IgG Fc using a Human Antibody Capture Kit (GE Healthcare), according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: Proteins from the samples were purified by a modified trichloroacetic acid protein precipitation procedure (Clean-Up Kit; GE Healthcare, Munich, Germany), and gel-assisted proteolysis was carried out ...
-
bioRxiv - Biophysics 2023Quote: ... were loaded with 10 μL of Aβ42 oligomer samples alongside the Amersham High Molecular Weight calibration kit for native electrophoresis (GE Healthcare, USA). The gels were run at 4°C using the electrophoresis system according to the Invitrogen instructions (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... An Fc capture chip was produced by amine coupling of anti-mouse IgG antibody to a CM5 chip using a commercial Fc Capture Kit (GE Healthcare). First ...
-
bioRxiv - Immunology 2024Quote: ... Detection was performed with the use of Pierce Fast Western Blot Kit in an Amersham Imager 600 (GE Healthcare Life Sciences)..
-
bioRxiv - Microbiology 2024Quote: Single Cononympha cells were collected using a Leica AM6000 micromanipulation system and subjected to whole genome amplification (WGA) using the illustra GenomiPhi V2 kit (GE Healthcare) as described previously [30] ...
-
bioRxiv - Genetics 2024Quote: ... and 5% dextran sulfate) at 65°C probed with 32P-labeled V5 DNA probes prepared via Amersham Megaprime DNA labeling kit (GE Healthcare) and Illustra ProbeQuant columns (GE Healthcare) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we introduced random mutations with Multi Primed Rolling Circle Amplification using the Illustra™ TempliPhi™ DNA Amplification Kit (GE Healthcare) with 2 mM of MnCl2 added to a final reaction volume of 10.8 µl ...
-
bioRxiv - Microbiology 2020Quote: ... The nsp7 and nsp8 genes were cloned into pGEX-6P-1 vector (GE Healthcare) with an N-terminal GST tag followed by a PreScission protease site ...
-
bioRxiv - Biochemistry 2020Quote: ... The eluate was then loaded onto 1 mL HiTrap Heparin HP column (GE Healthcare) and washed with 10 CVs Heparin Buffer (50 mM NaHEPES ...
-
bioRxiv - Cell Biology 2020Quote: ... backside blotted for 5-10 s with Whatman filter paper grade 1 (GE Healthcare) and vitrified in liquid ethane using a home-made manual plunger.
-
bioRxiv - Neuroscience 2020Quote: ... Tagmented fragments were purified with 1 volume of SPRI beads (1mL SeraMag GE Healthcare, 65152105050250 beads in 100mL of PEG8000 20% ...
-
bioRxiv - Neuroscience 2021Quote: ... placed in 5% milk PBST plus 1:2500 mouse specific HRP antibodies (GE Healthcare) at room temperature for 4 hours ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-mouse or anti-rat secondary antibodies (1:4000 in blocking buffer, GE Healthcare) for 1 hour at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... The Flow-Through was loaded in a 1 ml RESOURCE S column (GE Healthcare), and eluted through a 25 ml gradient (100 mM-1 M NaCl) ...
-
bioRxiv - Cell Biology 2019Quote: ... the samples were incubated with biotinylated sheep anti-mouse (1:200, RPN1001V, GE Healthcare) followed by peroxidase labeled streptavidin (1:500 ...
-
bioRxiv - Cell Biology 2019Quote: GST-tagged mammalian ATG8 fusion proteins were cloned into pGEX-4T-1 (GE Healthcare) and expressed in Escherichia coli BL21 (DE3 ...
-
bioRxiv - Cell Biology 2019Quote: ... and HRP-linked Sheep Anti-Mouse IgG (1:2000; GE Healthcare Life Sciences, NAG31V). For the analysis of p65 NFκB localisation and phosphorylation ...
-
bioRxiv - Molecular Biology 2019Quote: ... and α-mouse HRP-linked F(ab’)2 (GE Life Sciences NA9310; 1:5000). Blots were visualized by chemiluminescence with the SuperSignal West Femto kit (Pierce ...
-
Transcription factor LSF facilitiates lysine methylation of α-tubulin by microtubule-associated SET8bioRxiv - Biochemistry 2019Quote: ... SET8 and α-tubulin cDNAs were cloned into the pGEX-5X-1 (GE Healthcare) or pMalC4X (New England Biolabs ...
-
bioRxiv - Biochemistry 2019Quote: ... Protein expression was induced by adding (isopropyl β-D-1-thiogalactopyranoside, IPTG; GE Healthcare) to a final concentration of 0.3 mM ...
-
bioRxiv - Biochemistry 2019Quote: ... and coverslips were incubated with 1:100 primary anti-bromodeoxyuridine antibody (RPN202; GE Healthcare) in the dark for 1 h ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 mM DTT) and purified by anion exchange chromatography (MonoQ 5/50GL, GE Healthcare) on an AKTA pure chromatography system (GE Healthcare) ...
-
bioRxiv - Genetics 2019Quote: ... or HRP-conjugated anti-mouse IgG (GE Healthcare NA931V, Lot 9648752; 1:10000 dilution). Signals were produced by enhanced chemiluminescence (ECL ...
-
bioRxiv - Genetics 2020Quote: ... an additional step of purification with a 1 ml HiTrap Talon column (GE Healthcare) was used in between HiTrap Heparin HP (GE Healthcare ...
-
bioRxiv - Biochemistry 2020Quote: ... and IgG anti-rabbit horseradish peroxidase–conjugated secondary antibody (1:10,000; GE Healthcare UK). For whole cerebellum and cerebellar slices ...