Labshake search
Citations for GE Life Sciences :
1401 - 1450 of 1948 citations for Hydrogen Peroxide Colorimetric Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... The membranes were revealed using the ECL kit (GE Healthcare RPN2232), and images were captured on ImageQuant LAS 4000 (GE Healthcare ...
-
bioRxiv - Cell Biology 2024Quote: ... The column was calibrated using a kit (GE Healthcare Life Sciences) containing standards of known molecular weight ...
-
bioRxiv - Plant Biology 2023Quote: ... Proteins were detected with ECL Advance kit (GE Healthcare,Poole UK).
-
bioRxiv - Neuroscience 2023Quote: ... software (Artificial-Intelligent Radio-Genomics Kits; GE Healthcare, Chicago, IL, USA) used in [1] is not publicly available ...
-
bioRxiv - Neuroscience 2023Quote: ... and processed for immunoblotting using the ECL Prime kit (GE Healthcare). Immunoblot images were captured using a ChemiDoc Gel Imaging System (Bio-Rad ...
-
bioRxiv - Biochemistry 2023Quote: ... The immunoreaction was visualized with ECL chemiluminescence kit (GE Healthcare Amersham) following manufacturer’s instructions ...
-
bioRxiv - Biophysics 2022Quote: ... SEC columns were calibrated with a protein standard kit (GE Healthcare) containing ferritin (MW = 440 kDa ...
-
bioRxiv - Microbiology 2023Quote: ... 0.2 M Na3PO4 (#28-9030-59, Ab Buffer Kit, GE Healthcare). Beads were incubated at 4°C on a rotator ON ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were then revealed using an ECL kit (GE Healthcare) and the iBrightTM CL1500 system (Thermofisher).
-
bioRxiv - Neuroscience 2023Quote: ... The immunocomplex bands were visualized by the ECL kit (GE Healthcare), then analyzed with the ImageJ software (NIH) ...
-
bioRxiv - Cancer Biology 2024Quote: ... pre-calibrated using the Gel Filtration HMW Calibration Kit (GE Healthcare). 500 μl elute was collected for each fraction at a flow rate of 0.5ml/min ...
-
bioRxiv - Plant Biology 2019Quote: ... and electrotransfered (2 h at 80 V or 16 h at 30 V and 4°C) onto polyvinylidene difluoride membrane (Amersham, GE Healthcare). The recombinant enzymes were probed using anti-V5-HRP conjugated antibody (Invitrogen) ...
-
bioRxiv - Biophysics 2021Quote: ... the sample was concentrated to 2 mL and loaded onto a HiPrep 16/60 Sephacryl S-300 HR column (GE Healthcare) equilibrated and run in Sizing Buffer (50 mM HEPES pH 7.5 ...
-
bioRxiv - Microbiology 2020Quote: ... The clarified cell lysates were incubated for 2 h on a spinning wheel at 4°C with 100µl of StrepTactin Sepharose High Performance beads (#28935599, GE Healthcare, USA). Beads were collected by centrifugation (1600 g for 5 min at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... were incubated with GST or GST-tagged angulin-1 cytoplasmic region (409-575 aa or 409-570 aa) for 2-3 h at 4°C and further incubated with Glutathione Sepharose 4B beads (GE Healthcare) for 1 h at 4°C ...
-
bioRxiv - Biochemistry 2020Quote: Proteins (200 μl at 2 μM) were separated on a Superdex 200 Increase 10/300 GL column (GE Healthcare Life Sciences) equilibrated in PBS ...
-
bioRxiv - Molecular Biology 2020Quote: ... Lysed cells were centrifuged 20,000 xg for 30 minutes at 4C and soluble lysate was filtered prior to IMAC purification using 2×5mL His-Trap columns (GE Healthcare) affixed to an Akta Pure ...
-
bioRxiv - Molecular Biology 2021Quote: ... The PAGE gel was exposed to a phosphosimage screen for ∼2 hours and analyzed using a Amersham Typhoon imaging system (GE Healthcare). Band intensities corresponding to the uncleaved ribozymes and the two products of self-scission were analyzed using ImageQuant (GE Healthcare ...
-
bioRxiv - Molecular Biology 2021Quote: ... Then the mixture was centrifuged for 2 mins and the supernatant was desalted by filtration with a Sephacryl S-400 HR column (GE Healthcare), centrifuged at 16 krpm ...
-
bioRxiv - Biochemistry 2019Quote: ... analytical gel size-exclusion chromatography was performed with 1-2 mg protein in buffer A on a Superdex 75 10/300 column (GE Healthcare), to which a static light-scattering (SLS ...
-
bioRxiv - Biochemistry 2019Quote: ... Protein was loaded at concentrations ranging from 2 to 16 mg/ml on a Superdex 200 10/300 GL column (GE Healthcare) equilibrated in 20 mM HEPES ...
-
bioRxiv - Biochemistry 2020Quote: ... and 2 mM DTT for 1 hour prior to purification on a Superdex 200 10/300 size-exclusion column (GE Healthcare). Rac1 (G12V ...
-
bioRxiv - Biochemistry 2019Quote: ... A 50-μl protein sample (1-2 mg/ml) was analyzed on a Superdex S-200 10/300 GL column (GE Healthcare) pre-equilibrated with a buffer containing 20 mM Tris-HCl (pH 8.0) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Stoichiometric amounts of each core histone were incubated together under high salt conditions (2 M NaCl) and the resulting histone octamer purified using a Superdex 200 gel filtration column (GE Healthcare). Purified 147bp DNA carrying the 601 nucleosome-positioning sequence was a kind gift from the Brockdorff lab ...
-
bioRxiv - Biochemistry 2019Quote: ... the purified sample was concentrated to 2 mL and loaded onto a HiPrep 16/60 Sephacryl S-300 HR column (GE Healthcare) equilibrated and run in Sizing Buffer (50 mM HEPES pH 7.5 ...
-
bioRxiv - Biophysics 2021Quote: ... After dialysis the histones in 2 M NaCl were concentrated to a volume of 1 mL and purified using an Superdex 200 column (GE Healthcare) on an FPLC (Agilent) ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins were concentrated to 2 mL and further purified by size-exclusion chromatography using HiLoad 16/600 Superdex 200 (Ge healthcare).
-
bioRxiv - Biochemistry 2021Quote: ... The purified protein was then concentrated to 2 mL and purified by FPLC sizeexclusion chromatography using a Superdex 75 10/300 GL (GE Healthcare) column into 20 mM NaPO4 150 mM NaCl pH 7.5 ...
-
bioRxiv - Bioengineering 2020Quote: ... The ligase was inactivated with 2 M NaCl and the sample was injected into a Sephacryl S-1000 size exclusion column (GE Healthcare) to remove excess oligos and DNA ligase.
-
bioRxiv - Bioengineering 2020Quote: Binding of SARS-CoV-2 RBD to ACE2 –Fc and ACE2mod–Fc fusion proteins were measured using a Biacore T200 instrument (GE Healthcare). Fusion proteins were first immobilized at a coupling density of ∽1000 response units (RU ...
-
bioRxiv - Biochemistry 2021Quote: 50 μl of the N protein samples (1 mg/ml) purified according to protocols 1 or 2 were loaded onto a Superdex 200 Increase 10/300 column (GE Healthcare) pre-equilibrated with 20 mM HEPES ...
-
bioRxiv - Neuroscience 2020Quote: ... 150 mM NaCl) containing 5% skim milk (Meiji) and subjected to primary antibody for 2 h and HRP-conjugated secondary antibody (GE Healthcare) for 30 min ...
-
bioRxiv - Biophysics 2021Quote: ... The flow through containing SARS-CoV-2 Mpro was collected and further purified using size exclusion chromatography column (G-100, GE Healthcare,) equilibrated with 20 mM Tris ...
-
bioRxiv - Cell Biology 2021Quote: ... myogenic differentiation was induced by replacing the medium with differentiation medium (DM) consisting of DMEM supplemented with 2% horse serum (GE Healthcare) and PS ...
-
bioRxiv - Biochemistry 2020Quote: ... The cleaved protein was separated from any His6-tagged species by passage through the Ni+2-NTA HisTrap HP column and purified further using size-exclusion chromatography (Superdex S75, GE Healthcare). This also served to exchange the protein in a buffer optimized for NMR experiments (noted below) ...
-
bioRxiv - Cell Biology 2021Quote: ... The mass evaluated using UV as concentration source was 55.7 kDa for the 2 mg/ml sample.The Odinarchaeota samples were analysed by SEC-MALS (100 μl protein complex at 2 mg/ml) were passed over a Superdex 200 10/300 Increase GL column (GE Healthcare), in 20 mM Tris (pH 8.0) ...
-
bioRxiv - Cell Biology 2021Quote: ... and 2 mM DTT followed by size exclusion chromatography to remove any protein aggregates using a Superdex 75 column (GE Healthcare) in 25 mM HEPES (pH 7.5) ...
-
bioRxiv - Plant Biology 2020Quote: ... Desalting columns (NAP-5 and PD-10) and N-[6-(Biotinamido)hexyl]-3’-(2’-pyridyldithio)proprionamide (HPDP-biotin) were purchased from GE Healthcare and Pierce ...
-
bioRxiv - Cancer Biology 2020Quote: ... purified RNA was electrophoresed in non-denaturing 2% agarose TBE gel and then gel was blotted onto an Hybound-N nylon membrane (RPN303N, GE Healthcare) by semidry electroblotting in 0.5× TBE buffer for 2 hours at 200mA ...
-
bioRxiv - Biophysics 2021Quote: ... 100-μl protein samples (at approximately 2 mg/ml) were loaded onto a Superdex 200 or 75 10/300 GL Increase size-exclusion chromatography column (GE Healthcare) in 20 mM Tris HCl ...
-
bioRxiv - Biophysics 2020Quote: ... followed by 2 CV of 100% IEX buffer B using an ÄKTA Pure fast protein liquid chromatography (FPLC) system (GE Healthcare). To determine the point of elution of aSyn from the chromatography column protein fractions which were collected and monitored on absorption at 280 nm were ran on a 4-12% Bis-Tris gel (Invitrogen ...
-
bioRxiv - Biophysics 2021Quote: ... Peak fractions were pooled, diluted ~5 fold with buffer 0 (20 mM HEPES, 2 mM DTT) and loaded onto a Q column (GE Healthcare). Rad33 was then eluted from the Q column using a linear gradient of Q buffer A (20 mM HEPES ...
-
bioRxiv - Neuroscience 2022Quote: ... Truncated mouse RANKL transcript (encoding amino acids 137-316 of mouse RANKL) was PCR amplified (forward primer: CACCCCCGGGCAGCGCTTCTCAGGAGCT, reversed primer: GAGACTCGAGTCAGTCTA TGTCCTGAAC) and then cloned into pGEX-5X-2 vector (GE Healthcare) between SmaI and XhoI sites ...
-
bioRxiv - Immunology 2022Quote: The binding kinetics and affinity of recombinant monoclonal antibodies for the SARS-CoV-2 RBD protein (SinoBiological) were analyzed by SPR (Biacore T200, GE Healthcare). Specifically ...
-
bioRxiv - Biophysics 2022Quote: Binding kinetics of ACE2 and SARS-CoV-2 RBDs were determined by surface plasmon resonance using a Biacore S200 (GE Healthcare). All experiments were performed in a running buffer composed of 10 mM HEPES ...
-
bioRxiv - Biochemistry 2022Quote: The binding kinetics of mAbs to SARS-CoV-2 Delta-RBD or Omicron-RBD monomer were analyzed using SPR (Biacore 8K; GE Healthcare). Specifically ...
-
bioRxiv - Immunology 2022Quote: ... 500 μL of the proteins ranging from 2 mg/mL – 4 mg/mL concentration were loaded on an analytical Superose 6 Increase 10/300 column (GE Healthcare) and eluted in 1x PBS (pH 7.4 ...
-
bioRxiv - Biophysics 2022Quote: ... Peak fractions were diluted with 2 volumes of buffer H and loaded onto a 1-mL SP HP column (GE Healthcare) and washed with buffer C (50 mM HEPES pH 7.5 ...
-
bioRxiv - Biochemistry 2022Quote: ... The supernatant was supplemented with 4 mM CaCl2 and stirred for 2 h in 4°C with CaM-Sepharose beads (GE Healthcare), pre-equilibrated with binding buffer (50 mM Tris/HCl pH 7.2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... the gel was washed with the wash buffer and the IF3-bound complexes were eluted by additional incubation of 2 h with the PreScission protease (GE Healthcare) (2 U/μl).