Labshake search
Citations for IDT DNA :
101 - 150 of 231 citations for DNA Purification kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: ... Lag42 was synthesized as a gBlock (IDT DNA technologies) and cloned into pAW240 ...
-
bioRxiv - Physiology 2021Quote: ... we designed primers to detect the mutation (IDT DNA technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... were combined in duplex buffer (IDT DNA, 2.8 ul), annealed together (5 mins ...
-
bioRxiv - Microbiology 2022Quote: ... mAID-coding sequence was first synthesized (IDT DNA gBlock) and cloned into a pBluescript SK vector ...
-
bioRxiv - Immunology 2022Quote: ... as well as 20 mM electroporation enhancer (IDT DNA). RNPs were incubated for 15 min at RT and directly used for electroporation.
-
bioRxiv - Neuroscience 2022Quote: ... oligonucleotide primers for generating an ISH template (IDT DNA) were ordered commercially [similar to Bautista et al ...
-
bioRxiv - Biophysics 2023Quote: ... Sequence was verified by nucleotide sequencing (IDT DNA, I). AChRs were transiently expressed in HEK 293 cells by transfecting (CaPO4 precipitation ...
-
bioRxiv - Molecular Biology 2023Quote: ... an insert (derived from G-block #13; IDT DNA) carrying 102 bp of the φ10 promoter sequence (identical to the sequence found in pTF1 (ATCC 77397) ...
-
bioRxiv - Biophysics 2023Quote: ... Oligonucleotides were obtained from Integrative DNA Technologies (Coralville, IA) and Biosearch Technologies (Hoddesdon ...
-
bioRxiv - Microbiology 2023Quote: ... mAID-coding sequence was first synthesized (IDT DNA gBlock) and cloned into a pBlueScript SK vector ...
-
bioRxiv - Microbiology 2023Quote: ... All primers were ordered from IDT DNA (Table S3).
-
bioRxiv - Immunology 2024Quote: ... 65 pmol of sgRNA targeting mouse Pdl1 (IDT DNA) and 30 pmol of S.p ...
-
bioRxiv - Molecular Biology 2022Quote: Electrophoretic mobility shift assays were performed with different competitor DNA (ssDNA-salmon sperm DNA) conditions than SELEX-seq using Fam-labled dsDNA probes were generated by annealing upper fam labeled oligos (IDT DNA, Supplementary table 1). Briefly ...
-
bioRxiv - Cell Biology 2022Quote: ... and eluted in 15 μL of IDTE buffer (IDT DNA). 1 μL of this purified product was used for PCR-3 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The microRNA target (miR-206) was commercially synthesized (IDT DNA). Total RNA from HeLa cells was purchased from BioChain Institute Inc.
-
bioRxiv - Immunology 2021Quote: ... 5 µg/ml TLR9-activator ODN2006 (IDT DNA, sequence TCGTCGTTTTGTCGTTTTGTCGTT), and 60 µg/ml transferrin (Sigma #616424 ...
-
bioRxiv - Pathology 2021Quote: The sequences of all oligonucleotides (P1-P12, IDT DNA Technologies) are listed in Table 1 ...
-
bioRxiv - Genetics 2021Quote: ... and an siRNA for Lig4 (IDT DNA, Supplement Table S1).
-
bioRxiv - Microbiology 2022Quote: ... These assembled BCR sequences were synthesized into GeneBlocks (IDT DNA) and then cloned in the pTRIOZ-hIgG1 plasmid (InvivoGen ...
-
bioRxiv - Plant Biology 2022Quote: ... All primers and probes were synthesized by Integrative DNA Technologies.
-
bioRxiv - Synthetic Biology 2024Quote: ... all primers were synthesized by Integrative DNA Technologies (Coralville, IA), and all PCR reactions were set up with Q5 Master Mix (New England Biolabs ...
-
bioRxiv - Cell Biology 2022Quote: ... and crRNA(s) for the target (IDT DNA, 2.7μL at 100μM) with duplex buffer (IDT DNA ...
-
bioRxiv - Genetics 2019Quote: AACAC oligonucleotide probe was obtained from Integrative DNA Technologies (IDT, www.idtdna.com). Sequence ...
-
bioRxiv - Genomics 2019Quote: ... gRNA constructs were ordered from Integrative DNA Technologies (Coralville, Iowa, USA) as DNA (gBlocks) ...
-
bioRxiv - Biochemistry 2020Quote: ... followed by insertion of a gene block (synthesized by IDT DNA) encoding the peptide sequence and a linker by an in-fusion reaction ...
-
bioRxiv - Cell Biology 2022Quote: ... An injection mix containing Cas9 (IDT DNA, 0.5μL at 10mg/mL), annealed crRNA ...
-
bioRxiv - Microbiology 2022Quote: ... The second fragment was synthesized as a gBlock (Integrative DNA Technologies) consisting of 5’-XhoI – simian virus 40 nuclear localization sequence (- TCATCCGATGACGAGGCCACAGCTGATTCCCAGCACTCAACTCCGCCTAAAAAAAAAAGAA AAGTT ...
-
bioRxiv - Developmental Biology 2022Quote: ... Mutated enhancers were custom synthesized as gene blocks (gBlocks, IDT DNA) (Supplementary Table 3 ...
-
bioRxiv - Microbiology 2023Quote: ... The primers used in this study were synthesized by IDT DNA Technologies and are described in Table S5 ...
-
bioRxiv - Cell Biology 2022Quote: ... An injection mix containing Cas9 (IDT DNA, 0.5μL at 10mg/mL), annealed crRNA ...
-
bioRxiv - Genomics 2022Quote: ... CellTag-multi barcodes were obtained as a gBlock from IDT DNA (see Supplementary Table 1 for sequence ...
-
bioRxiv - Microbiology 2023Quote: ... or by PCR amplification of a synthesized gblock (IDT DNA technologies) for the ΔhsdS mutant ...
-
bioRxiv - Molecular Biology 2024Quote: Cargo constructs were ordered as eBlock Gene Fragments from IDT DNA and cloned by Gibson Assembly ...
-
bioRxiv - Cancer Biology 2024Quote: ... RhAMP SNP primers were designed by IDT DNA (assay name CD.GT.WVSM3699.1). RhAMP SNP assay was carried out per manufacturer’s protocol on a QuantStudio 12K Flex (Applied Biosystems ...
-
bioRxiv - Genetics 2019Quote: ... Primers for the mutagenesis were synthesized by IDT DNA (Coralville, IA, USA) and are listed in S2 Table ...
-
bioRxiv - Bioengineering 2021Quote: ... (AC)15 and CT2C3T2C) were purchased from IDT DNA (Coralville, IA, USA). Human epididymis protein 4 (HE4 ...
-
bioRxiv - Biochemistry 2021Quote: ... Oligos used for the site directed mutations were purchased from IDT DNA.
-
bioRxiv - Biochemistry 2020Quote: ... coli MBP (malE) was obtained as a gBlock (IDT DNA, Table S1). BsaI sites were added to ends by PCR with complementary overhangs for golden gate cloning into pATT-Dest (Addgene plasmid #79770 ...
-
bioRxiv - Developmental Biology 2021Quote: ... were commercially synthesized (Genscript USA, Piscataway NJ; or IDT DNA, Coralville, IA) and cloned into the pGL4.23 firefly luc2/miniP vector (Promega E8411) ...
-
bioRxiv - Microbiology 2021Quote: ... The 5’6-FAM/dArUdAdA/3’-TAMRA oligonucleotide was purchased from IDT DNA Inc (Coralville ...
-
bioRxiv - Genomics 2019Quote: Short ssODN GFP11 donors templates (Ultramer, <200nt) were purchased from IDT DNA.
-
bioRxiv - Molecular Biology 2023Quote: ... Crispr RNA (crRNA) and tracer RNA (trRNA) were purchased from IDT DNA Technologies (Coralville ...
-
bioRxiv - Systems Biology 2023Quote: ... IRDye 700-labeled and non-labeled probes were purchased from IDT DNA technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... and crRNA(s) for the target (IDT DNA, 2.7 μL at 100μM) with duplex buffer (IDT DNA ...
-
bioRxiv - Synthetic Biology 2023Quote: ... These plasmids were constructed by isothermal assembly of G-Blocks (IDT DNA) or PCR fragments ...
-
bioRxiv - Bioengineering 2023Quote: ... at a final concentration of 3 μM and electroporation enhancer (IDT DNA) at a final concentration of 30 μM were added to the gRNA mix ...
-
bioRxiv - Microbiology 2023Quote: FapA gene block was ordered from Twist Bioscience and primers (IDT DNA) were used to clone into pET32 vector using In-fusion cloning mechanism (Takara Bio) ...
-
bioRxiv - Immunology 2024Quote: ... The CAR cassette was synthesized as a gBlock fragment from IDT DNA, amplified by primer 13 and 14 ...
-
bioRxiv - Physiology 2024Quote: ... with DsiRNA (Integrative DNA Technologies, Coralville, IA; Cat# 51-01-14-03) used as a negative control ...
-
bioRxiv - Molecular Biology 2024Quote: ... Spliceosome proteins for fusion experiments were ordered as eBlocks from IDT DNA. An expression backbone originally containing wild-type Cas7-11 (pDF0506 ...