Labshake search
Citations for IDT DNA :
151 - 200 of 231 citations for DNA Polymerase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... Taqman PCR was performed with conditions according to the manufacturer’s instructions (IDT DNA) on the ViiA 7 system (Applied Biosystems) ...
-
bioRxiv - Bioengineering 2019Quote: ... The genes were then ordered as synthetic gene strings from IDT DNA (MsEgtA) or GeneArt (all other synthetic gene strings) ...
-
bioRxiv - Biochemistry 2020Quote: ... This was combined with tracrRNA-ATTO 550 (IDT DNA Technologies, Skokie, Ill, USA) to a final duplex concentration of 44μM to form the complete guide RNA complex ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.3μl of 61μM Cas9 nuclease stock solution (IDT DNA Technologies, Skokie, Ill, USA) was combined with 0.2μl of Resuspension Buffer R (IDT DNA Technologies ...
-
bioRxiv - Microbiology 2020Quote: All plasmids are listed in Table 2 and oligonucleotides purchased from IDT DNA or Fisher used for their construction are listed in Table 3 ...
-
bioRxiv - Microbiology 2021Quote: ... a 4 nucleotide chimeric substrate was commercially synthesized (IDT DNA Inc., Coralville, IA) with a 5’ carboxyfluorescein (FAM ...
-
bioRxiv - Microbiology 2019Quote: ... The ermE*p was synthesized as a double stranded BioBrick gBlock (IDT DNA). Snoa123 was amplified via polymerase chain reaction from S ...
-
bioRxiv - Immunology 2021Quote: ... 6xHis-SUMO-XCL1(CC3)-FLAG was ordered as a gBlock from IDT DNA Technologies and cloned in digested pET28a(+ ...
-
bioRxiv - Cell Biology 2022Quote: ... The final injection mix containing Cas9 (IDT DNA, 0.5 ul at 10mg/ml), annealed crRNA and tracrRNA along with the repair template for the mutation and a co-CRISPR marker (unc-58 or dpy-10 ...
-
bioRxiv - Cell Biology 2022Quote: ... An injection mix containing Cas9 (IDT DNA, 0.5 μl at 10 mg/ml), annealed crRNA and tracrRNA along with the repair template was incubated at 37°C for 15 minutes before the debris in the mix was pelleted (15 mins ...
-
bioRxiv - Bioengineering 2022Quote: ... All oligos and lipid oligos were ordered as custom syntheses (Integrative DNA Technologies), resuspended to either 5 mM (photopatterning ssDNA ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were generated using the Alt-R CRISPR-Cas9 System (IDT DNA Technologies) following the manufacturer’s protocol with the following modifications ...
-
bioRxiv - Immunology 2023Quote: ... Control cells were transfected with the nuclease duplex buffer from IDT DNA (USA) instead of crRNA.
-
bioRxiv - Cell Biology 2019Quote: The 359-bp probe (Figure 4d) was ordered from Integrative DNA Technologies (IDT, www.idtdna.com) with 5’ Cy5 ...
-
bioRxiv - Biochemistry 2019Quote: ... A clean deletion of rsbTU was generated by generating a gBlock (IDT DNA Technologies) of regions corresponding to 500 bp upstream of rsbT and 500 bp downstream of rsbU ligated together ...
-
bioRxiv - Biochemistry 2020Quote: ... was combined with 0.2μl of Resuspension Buffer R (IDT DNA Technologies, Skokie, Ill, USA). To form the crRNA:tracrRNA:Cas9 complex ...
-
bioRxiv - Cell Biology 2021Quote: ... and reverse transcription was performed using the SuperScript II RT kit (Integrative DNA Technologies) with total RNA (1 μg ...
-
bioRxiv - Neuroscience 2020Quote: ... We amplified zf-tdTomato from a gBlock (IDT DNA, full sequence available upon request) with primers zftdTomato fwd and zftdTomato rev and the p3E-tagRFPtcntn1a backbone (excluding tagRFPt ...
-
bioRxiv - Microbiology 2020Quote: ... A bacteria-codon optimized gBlock for the truncated protein was produced by IDT DNA Technologies and cloned into a pET28a bacterial expression with a C-terminal 6xHis tag using the NEBuilder Assembly Kit (New England Biolabs) ...
-
bioRxiv - Genetics 2022Quote: ... cDNA fragments were ligated to IDT for Illumina unique dual adapters (IDT DNA Inc). Quality and quantity of the finished libraries were assessed using a combination of Agilent DNA High Sensitivity chip (Agilent Technologies) ...
-
bioRxiv - Biochemistry 2020Quote: ... The random ssDNA molecule and the dimeric random controls were purchased from IDT DNA Technologies.
-
bioRxiv - Biochemistry 2021Quote: ... The remaining hybrid constructs as well as CpAtg8 were purchased as gBlocks (IDT DNA) and inserted into pfYC110 via AvrII-SacII sites.
-
bioRxiv - Cell Biology 2022Quote: ... and designed crRNA(s) for the target (IDT DNA, 2.75 μl at 100 μM) with duplex buffer (IDT DNA ...
-
bioRxiv - Genetics 2022Quote: ... Locus-specific crRNAs were selected using a combination of rating algorithms from IDT DNA and CRISPRscan.73 Candidate crRNAs that scored at least 40 (range 0-100 ...
-
bioRxiv - Molecular Biology 2024Quote: ... a T7 promoter oligonucleotide (CCTGGCTAATACGACTCACTATAG) was annealed to an anti-sense Ultramer (IDT DNA) encoding the entire sgRNA in addition to the T7 promoter ...
-
bioRxiv - Biophysics 2024Quote: ... Point mutants were generated by PCR site-directed mutagenesis with primers from IDT DNA Technologies ...
-
bioRxiv - Biochemistry 2020Quote: ... and 2μl of 10 μM electroporation enhancer (Alt-R Cas9 Electroporation Enhancer, IDT DNA Technologies). To prepare the Neon Transfection System for electroporation ...
-
bioRxiv - Neuroscience 2020Quote: ... Real-time PCR reactions were run in quadruplicate using PrimeTime qPCR Primer Assays (IDT DNA) and PrimeTime® Gene Expression Master Mix (IDT DNA ...
-
bioRxiv - Microbiology 2022Quote: ... Primers used for mutagenesis can be found in Table S2 and purchased from IDT DNA Technologies (Coralville ...
-
bioRxiv - Cancer Biology 2022Quote: ... the Cas9:crRNA:tracrRNA ribonucleoprotein (RNP) complex was assembled according to the manufacturer’s recommendations (IDT DNA) and transfected into the cells using Lipofectamine RNAiMAX reagent (Invitrogen) ...
-
bioRxiv - Cancer Biology 2021Quote: ... or the C’-terminus (amino acids 87-164) were synthesized by IDT DNA (Coralville, IA) and cloned into lentiviral vectors containing a Tet-inducible promoter (pLenti-CMV-TRE3G-Puro ...
-
bioRxiv - Immunology 2024Quote: ... the BaEVRless gene was codon-optimized and synthesized as a gBlock fragment from IDT DNA. The BaEVRless sequence was amplified from the gBlock by KAPA HiFi HotStart PCR kit using primer 1 and 2 ...
-
bioRxiv - Bioengineering 2022Quote: ... The RNP was made by incubating gRNA and High Fidelity Cas9 protein (Integrative DNA Technologies, USA) at a molar ratio of 1:2 at 37 °C for 15 min ...
-
bioRxiv - Neuroscience 2020Quote: ... Other cassettes were either cloned from other existing vectors or synthesized de novo (IDT DNA Technologies). The vectors were then packaged into lentiviruses pseudotyped with VSV-G to produce ...
-
bioRxiv - Microbiology 2021Quote: ... Inserts were generated by PCR amplification with cloning primers from Integrative DNA Technologies (Coralville, IA, USA) of C ...
-
bioRxiv - Genomics 2019Quote: ... Two guide RNAs (sgRNA) flanking 573 base pairs containing rs2366739 and rs1194196 were designed (IDT DNA). The design of sgRNA pairs for targeting and prediction of off-target sites were based on online tools ...
-
bioRxiv - Genetics 2022Quote: ... All CRISPR-Cas9 reagents (crRNAs, tracrRNAs, Cas9, Cat# 1081058) were obtained from IDT DNA (Coralville, IA). Locus-specific crRNAs were selected using a combination of rating algorithms from IDT DNA and CRISPRscan.73 Candidate crRNAs that scored at least 40 (range 0-100 ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribonucleoprotein complex (RNP) were prepared by annealing 20 µM crRNA with 20 µM tracrRNA (IDT DNA) at 95°C ...
-
bioRxiv - Biochemistry 2023Quote: ... Gene blocks of MMP-9Cat variants Des 3 and Des 4 were purchased from IDT DNA, USA ...
-
bioRxiv - Immunology 2023Quote: ... 3.3 μM of sgRNA were incubated with Alt-R HiFi Cas9 Nuclease V3 (IDT DNA (USA) at 0.27 mg/mL and Alt-R HDR electroporation enhancer at 5 μM and then transfected into cells by using the Neon Electroporation System (Thermofisher ...
-
bioRxiv - Immunology 2020Quote: ... and host Actb (Forward: 5’-AGCTCATTGTAGAAGGTGTGG-3’; Reverse: 5’ - GGTGGGAATGGGTCAGAAG-3’; Probe: 5’-TTCAGGGTCAGGATACCTCTCTTGCT-3’; IDT DNA) against plasmid standard curves using TAQman universal master mix II on a StepOnePlus real time PCR system (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2020Quote: ... (pan)Ifna (Forward: 5’-CTTCCACAGGATCACTGTGTACCT-3’; Reverse: 5’-TTCTGCTC TGACCACCTCCC-3’; Probe: 5’-AGAGAGAAGAAACACAGCCC CTGTGCC-3’; IDT DNA)(Samuel & Diamond ...
-
bioRxiv - Bioengineering 2020Quote: ... and we prepared a mix consisting unless otherwise specified of sgRNA 40 pmol (Synthego or IDT DNA) purified SpyCas9 protein 30 pmol (PNA Bio ...
-
bioRxiv - Molecular Biology 2020Quote: ... coli C41(DE3) cells were transformed with the SARS-CoV-2 pET-28a-nsp5 plasmid (IDT DNA). Single colonies were used to inoculate LB media supplemented with kanamycin (50 μg/mL) ...
-
bioRxiv - Physiology 2022Quote: ... Primers were designed for gene specificity and to cross exon-exon junctions using Primer-BLAST (www.ncbi.nlm.nih.gov/tools/primer-blast/) and purchased from IDT DNA Technologies (Coralville ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Amplicons were then A-Tailed and ligated to xGen-UDI-UMI Adapters (Integrative DNA Technologies, Coralville, IA) using a KAPA HyperPrep PCR-Free kit (Roche ...
-
bioRxiv - Genomics 2020Quote: ... Lentiviral gRNA expression vectors were created by annealing two complementary oligonucleotides encoding gRNAs at 100 µM (IDT DNA) with sticky-ends and ligating annealed products into BsmB1 digested CROP-seq-opti vector using Golden Gate assembly ...
-
bioRxiv - Immunology 2021Quote: ... 0.7 µl template switch oligo (TSO) (10 µM, f/c 200 nM, IDT DNA; #110, Supplementary table 5), nuclease-free water till 35 µl and subsequent incubation at 42°C for 2 hours ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR was conducted to confirm the genotype of double or triple mutants using primers purchased from IDT DNA.
-
bioRxiv - Microbiology 2020Quote: ... a synthetic fragment for a recodonized 3’ sequence of exon 1 followed by the artificial loxPint (IDT DNA), and a PCR-amplified fragment of the 5’ end of pfpp1 exon 2 (601 bp) ...