Labshake search
Citations for Millipore Sigma :
251 - 300 of 2451 citations for hsa mir 940 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... NLRP3 primer pair (Sigma): forward 5’ -TCAGCACTAATCAGAATCTCACGCACCTTT -3’ and reverse 5’ -CCAGGTCATTGTTGCCCAGGCTC -3’ ...
-
bioRxiv - Microbiology 2021Quote: ... The primers (Sigma-Aldrich) used are listed below ...
-
bioRxiv - Microbiology 2021Quote: ... The primers (Sigma-Aldrich) used are listed below ...
-
bioRxiv - Immunology 2020Quote: ... The primers (Sigma–Aldrich) used are listed in Table 1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... with primers (Sigma-Aldrich) containing condition specific ...
-
bioRxiv - Immunology 2022Quote: ... DRAM1 primers (Sigma-Aldrich) used are as follows ...
-
bioRxiv - Genomics 2022Quote: ... Sequences of primers (Sigma) used are ...
-
bioRxiv - Microbiology 2022Quote: ... Primer pairs (Sigma Aldrich) are listed in the table below ...
-
bioRxiv - Neuroscience 2022Quote: ... Primer probes (Sigma-Aldrich) were designed to span exon boundaries ensuring amplification of only mRNA (see Table S1) ...
-
bioRxiv - Neuroscience 2023Quote: ... Primers pairs (Sigma-Aldrich) specific for Il6 ...
-
bioRxiv - Neuroscience 2023Quote: ... Oligonucleotide primers (desalted; Sigma) for genotyping targeted alleles and transgenes by PCR are described in Supplementary Table 2.
-
bioRxiv - Neuroscience 2023Quote: ... and oligonucleotide primers (Sigma). The DNA sequence of the entire coding region was then verified by Genewiz/Azenta to obtain point mutations T214F ...
-
bioRxiv - Cancer Biology 2022Quote: ... and phosphatase inhibitors (Phosphatase Inhibitor Cocktail Set I #524624 and Phosphatase Inhibitor Cocktail Set II #524625; Millipore Sigma-Aldrich), was added directly on the plated cells and lysed for 15 min on ice ...
-
bioRxiv - Systems Biology 2024Quote: ... the negative control set as 0.1% DMSO and the positive control set as 100 µM etoposide (Sigma Aldrich, Germany), and a media blank column (plated per column) ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNAs were PCR-amplified using specific primers (Table 1) and a JumpStart REDTaq ReadyMix Reaction Mix (Sigma-Aldrich, MO, USA). α-tubulin and water (“no DNA” ...
-
bioRxiv - Microbiology 2020Quote: ... The construction of baculovirus transfer vectors encoding hVP3 mutant polypeptides were generated using PCR-based site directed mutagenesis on the pFB/hisVP3 plasmid (Kochan et al. 2003) using synthetic DNA oligonucleotide primers (Sigma) described in Supplementary Table 1 ...
-
bioRxiv - Genomics 2022Quote: ... Conserved regions were amplified from genomic leaf DNA in a standard polymerase chain reaction (PCR) using specific primers synthesized commercially (Sigma). PCR products were labeled with biotin-16-dUTP or digoxigenin-11-dUTP using BioPrime CGH array labelling kit (Invitrogen) ...
-
bioRxiv - Immunology 2021Quote: ... genomic DNA was extracted from ear clips and amplified by polymerase chain reaction (PCR) using the relevant forward (FP: 5’AAACTGGGCTCTCCGCTGCTG3’) and reverse (RP:5’AGTAGAGTATCGTGCATGGTCCTGG3’) primers (Taq polymerase (Sigma) at an annealing temperature (Tm ...
-
bioRxiv - Biochemistry 2020Quote: ... encoding the cpeB gene from Prochlorococcus marinus MED4 was PCR amplified with primers (Table 4) encompassing selected recognition sites (EcoRI, HindIII) for cloning into pCOLADuet (Novagen).
-
bioRxiv - Molecular Biology 2022Quote: ... 0.5 μg of genomic DNA were used for PCR reaction with primer 495 and 489 (Supplemental Table 1) with Red taq (Sigma) with the following PCR condition ...
-
bioRxiv - Microbiology 2023Quote: ... gene was PCR amplified from individual spores with primers AML225 (GAACCCAAACACTTTGGTTTCC) and WANDA26 (CAGCCGCGGTAATTCCAGCT) using JumpStart RedTaq DNA Polymerase Master Mix (Sigma). PCR products were sent for cleaning and Sanger sequencing (Macrogen Europe) ...
-
bioRxiv - Microbiology 2023Quote: ... were obtained by PCR with the primers P1-P2 and P2-P4 respectively (Supplementary Table 2) and cloned into pETDuet-1 (Novagen) using the In-Fusion HD Cloning system (Clontech) ...
-
bioRxiv - Neuroscience 2023Quote: A 3 bp mutation was introduced into the CMV:dreammist-GFPpA by inverse PCR using specific primers (Table 2) and KOD high fidelity hot start polymerase (Millipore 71085). The template was degraded by DpnI digest and circular PCR product was transformed into OneShot TOP10 chemically competent E coli (Invitrogen C4040) ...
-
bioRxiv - Biophysics 2022Quote: ... into the WT-CaM construct in the pET21a vector using standard PCR mutagenesis after residue D80 of the protein sequence using primers ordered from Sigma-Aldridge (Merck) ...
-
bioRxiv - Molecular Biology 2024Quote: cDNAs of BTB domains were PCR-amplified using corresponding primers (Supplementary Table S1) and cloned into modified pET32a(+) vector (Novagen) encoding TEV protease cleavage site after 6xHis-tag and Thioredoxin ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were allowed to adhere for 24 hrs and then transfected with 25 nM of miRNA inhibitors against hsa-miR184 (Sigma #HSTUD0282), hsa-miR22-3p (Sigma #HSTUD0393 ...
-
bioRxiv - Bioengineering 2021Quote: ... were coated with 100 μl (5 μg/ml) of purified S1 or S1-RBD or commercial human serum albumin (HSA; Sigma-Aldrich) and incubated overnight at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... the WT and ΔfakA mutant were grown with fatty acid-containing and fatty acid-free HSA (Sigma-Aldrich, St. Louis, MO) at 10-40 mg/mL in TSB ...
-
bioRxiv - Microbiology 2021Quote: ... Primers were designed in Primer-BLAST51 and synthesized by Sigma-Aldrich (MO, USA). The designed primer pairs were specificity checked and optimised ...
-
bioRxiv - Microbiology 2019Quote: ... Triplicate reactions were started at RT in PCR tubes by addition of an NAD+-mixture resulting to final concentrations of 24.5 µM NAD+ (Sigma, N3014) and 0.5 µM of biotinylated NAD+ (Trevigen ...
-
bioRxiv - Molecular Biology 2023Quote: 10% of the RT reaction was used as the template in 25 μl PCR reactions containing 1.25U of JumpStart Taq Polymerase (Sigma D9307), 1×PCR buffer (Sigma P2192) ...
-
bioRxiv - Molecular Biology 2023Quote: FLAG-tagged or HA-tagged cDNA fragment of DDX43 was amplified by RT-PCR from total RNA of silkworm ovaries and cloned into pIEx-1 vector (Merck Millipore/Novagen) or pIExZ vector by In-fusion cloning kit (Takara).
-
bioRxiv - Molecular Biology 2023Quote: ... or MMLV-RT (Sigma), following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... protease inhibitor (Protease Inhibitor Cocktail Set III, Sigma)) and sonicated for 2 minutes (15s on ...
-
bioRxiv - Biochemistry 2020Quote: ... protease inhibitor (Protease Inhibitor Cocktail Set III, Sigma)) and sonicated for 2 minutes (15s on ...
-
bioRxiv - Neuroscience 2020Quote: ... and phosphatase inhibitor cocktail set III (Millipore-Sigma). Insoluble material was removed by centrifugation at 14,000g for 20 min at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... and phosphatase inhibitor cocktail set III (Millipore-Sigma). Insoluble material was removed by centrifugation at 14,000g for 20 min at 4°C ...
-
bioRxiv - Immunology 2020Quote: ... and Protease Inhibitor Cocktail Set V (EMD Millipore) were purchased from the indicated sources ...
-
bioRxiv - Molecular Biology 2019Quote: ... supplemented with 2x protease inhibitor cocktail set (Millipore)) ...
-
bioRxiv - Biochemistry 2021Quote: ... protease inhibitor (Protease Inhibitor Cocktail Set III, Sigma)) and sonicated for 2 minutes (15s on ...
-
bioRxiv - Biochemistry 2021Quote: ... protease inhibitor (Protease Inhibitor Cocktail Set III, Sigma)) and sonicated for 2 minutes (15s on ...
-
Synthetic lethal targeting of TET2-mutant hematopoietic stem and progenitor cells by XPO1 inhibitorsbioRxiv - Cancer Biology 2022Quote: ... and Phosphatase Inhibitor Cocktail Set II (EMD Millipore). Immunoblotting was performed with each of the specific antibodies to TET2 (CST ...
-
bioRxiv - Biochemistry 2022Quote: ... protease inhibitor (Protease Inhibitor Cocktail Set III, Sigma)) and sonicated for 2 minutes (15s on ...
-
bioRxiv - Biochemistry 2022Quote: ... protease inhibitor (Protease Inhibitor Cocktail Set III, Sigma)) and sonicated for 2 minutes (15s on ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1X protease inhibitor cocktail set I (Sigma, #539131). Extracts were clarified by centrifugation ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with protease inhibitor set I (Sigma, 539131) and phosphatase inhibitor set II (Sigma ...
-
bioRxiv - Biochemistry 2023Quote: ... protease inhibitor (Protease Inhibitor Cocktail Set III, Sigma)) and sonicated for 2 minutes (15s on ...
-
bioRxiv - Biochemistry 2023Quote: ... protease inhibitor (Protease Inhibitor Cocktail Set III, Sigma)) and sonicated for 2 minutes (15s on ...
-
bioRxiv - Developmental Biology 2024Quote: ... and Phosphatase Inhibitor Cocktail Set II (Millipore #524625) for 30 minutes at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... Ant-miR-218 or Ant-scrambled was dissolved in sterile PBS (Sigma-Aldrich, Oakville, ON, Canada) at a final concentration of 0.3nM and infused with a total volume of 0.5μl of Ant-miR-218 or Ant-scrambled over a 7-min period as in(31 ...