Labshake search
Citations for Millipore Sigma :
351 - 400 of 2449 citations for hsa mir 320a RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... combined with on-Column DNase I Digestion Set (Sigma). Reverse transcription was performed using qScript cDNA Synthesis Kit (Quanta biosciences ...
-
bioRxiv - Developmental Biology 2022Quote: ... The complete probe set was ordered from Sigma Aldrich. Equal volumes of all 20 single probes were mixed and used as probe mixture containing 5 μM of each probe in detection stage 3.
-
bioRxiv - Molecular Biology 2023Quote: ... The on-column DNase I digestion set (Sigma, DNASE70) was used for genomic DNA (gDNA ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The control group was set with 0.1% DMSO (Sigma), and the blank control was set with water ...
-
bioRxiv - Neuroscience 2023Quote: ... and Phosphatase Inhibitor Cocktail Set V (Merck Millipore, 524629). The samples were pipetted 10-20 times up and down until dissolved and were incubated on ice for 20 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... 35μM dTTP (Deoxynucleotide Set, 100mM, Sigma, Cat# DNTP100-KT), and 15μM DIG-11-dUTP (Digoxigenin-11-dUTP ...
-
bioRxiv - Cell Biology 2021Quote: ... pH 7.4, 100 mM NaCl, 10% glycerol, 1% Triton X-100, 2 mM EDTA, Roche complete protease inhibitor set, and Sigma phosphatase inhibitor set), incubated on ice for 30 min ...
-
bioRxiv - Neuroscience 2021Quote: ... using the SYBR™ Green master mix (life technologies) and predesigned primers (KiCqStart® Primers, Sigma). Relative gene expression levels were normalized to β-actin in each sample with the ΔΔCT method.
-
bioRxiv - Cancer Biology 2020Quote: ... Mutagenic oligonucleotide primers were designed using Agilent QuickChange Primer Design program and purchased from Sigma-Aldrich with PAGE purification with the following sequences:
-
bioRxiv - Microbiology 2020Quote: HSA was depleted from CSF by placing 1mL of CSF into a 30 kDa Amicon™ Ultra Centrifugal Filter (Millipore, Temecula, CA, United States) and the solution was centrifuged at 20,000 × g for 10 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... Primers were synthesized by Sigma-Aldrich Sweden AB (Stockholm ...
-
bioRxiv - Cell Biology 2019Quote: ... All primers were purchased from Sigma.
-
bioRxiv - Cell Biology 2022Quote: ... and 400nM primers (Sigma, Poole, UK). Reactions were performed on a BioRad CFX RT-qPCR machine using the following parameters ...
-
bioRxiv - Cell Biology 2022Quote: ... Primers were obtained from Sigma-Aldrich Custom DNA Oligo service ...
-
bioRxiv - Immunology 2019Quote: ... using the following primer pairs (Sigma): bActin For 5’GTTCCGATGCCCTGAGGCTC3’ ...
-
bioRxiv - Developmental Biology 2019Quote: ... The sequences of sg-primers (SIGMA) used in this study are included in Supplementary Table 2.
-
bioRxiv - Developmental Biology 2019Quote: ... Selected primers were synthesized (Sigma-Aldrich) with the T7 promoter primer sequence (TAATACGACTCACTATAGGGAG ...
-
bioRxiv - Systems Biology 2019Quote: ... Primers were synthesised by Sigma-Aldrich, UK ...
-
bioRxiv - Cancer Biology 2019Quote: ... All primers were purchased from Sigma.
-
bioRxiv - Microbiology 2019Quote: ... Primers were obtained from Sigma Aldrich. Sanger sequencing was performed at the Massachusetts General Hospital DNA Core Facility ...
-
bioRxiv - Physiology 2019Quote: ... Commercially available primers (Sigma Aldrich, KSPQ12012) were used to determine levels of cyclooxygenase 2 (COX2) ...
-
bioRxiv - Plant Biology 2020Quote: ... and poly-T primers (Sigma-Aldrich).
-
bioRxiv - Cell Biology 2021Quote: ... and gene-specific primers (Sigma Aldrich) as detailed in Supplementary Table 1 ...
-
bioRxiv - Biochemistry 2020Quote: ... and NNK randomized primers (Sigma, USA). The 3EFR-Cfr and GP2 libraries were constructed by extension amplifications of Aga2p gene together with NGL linker ...
-
bioRxiv - Systems Biology 2021Quote: ... Primers were purchased from Sigma Aldrich. The expression of the genes in the predictive signature was calculated relative to CD14 expression ...
-
bioRxiv - Neuroscience 2021Quote: ... Custom primers were purchased from Sigma and miRNA probes were from Life Technologies (Supplementary Methods ...
-
bioRxiv - Cancer Biology 2019Quote: ... Primers were obtained from Sigma-Aldrich and their sequences are detailed in Supplementary Table 2 and 3.
-
bioRxiv - Cell Biology 2020Quote: ... primers were purchased from Sigma-Aldrich. Hprt was used as housekeeping gene ...
-
bioRxiv - Biochemistry 2022Quote: ... DNA primers were purchased from Sigma.
-
bioRxiv - Biochemistry 2022Quote: ... Sequences of qPCR Primer (Sigma-Aldrich) are listed in Table S1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... All primers were purchased from Sigma. For each sample ...
-
bioRxiv - Immunology 2020Quote: ... Pre-designed KiCqStartTM primers (Sigma-Aldrich) were purchased to evaluate β-Actin ...
-
bioRxiv - Neuroscience 2020Quote: ... Primers were synthesized by Sigma-Aldrich Custom DNA Oligo service ...
-
bioRxiv - Genetics 2022Quote: ... with random hexanucleotide primers (Sigma-Aldrich). Quantitative PCR amplification of cDNA was carried out using the SYBR Premix Ex Taq II (Ozyme ...
-
bioRxiv - Microbiology 2022Quote: ... Primers were synthesized by Sigma-Aldrich. PCRs were performed with Phusion ...
-
bioRxiv - Cell Biology 2022Quote: ... Primers were purchased from Sigma-Aldrich. Please refer to the supplemental information Table 1 for a complete list of primers used.
-
bioRxiv - Immunology 2019Quote: ... Primers were synthesized from Sigma Aldrich Chemicals Ltd ...
-
bioRxiv - Cell Biology 2019Quote: ... Primer oligonucleotides were synthesized by Sigma and are listed in Supplementary Table S1.
-
bioRxiv - Bioengineering 2020Quote: ... Primers were ordered from Sigma-Aldrich. Inserts were verified by Sanger sequencing (by Microsynth Seqlab ...
-
bioRxiv - Molecular Biology 2021Quote: ... Primers were synthesized by Sigma Aldrich with 5′biotin modification or without modification for control primers (Supplementary Table 1) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Primers were synthesized by Sigma-Aldrich and enzymes for molecular cloning were obtained from New England Biolabs.
-
bioRxiv - Immunology 2019Quote: ... All primers were purchased from Sigma.
-
The Vagus Nerve Mediates the Physiological but not Pharmacological Effects of PYY3-36 on Food IntakebioRxiv - Physiology 2020Quote: ... All primers were supplied by Sigma A-ldrich (Dorset ...
-
bioRxiv - Cancer Biology 2021Quote: ... SYBR primers were obtained from Sigma or Integrated DNA Technologies (IDT) ...
-
bioRxiv - Cell Biology 2020Quote: ... Oligonucleotide primers were from Millipore Sigma. Restriction enzymes were from New England BioLabs ...
-
bioRxiv - Immunology 2020Quote: ... using oligo-dT6 primers (Sigma-Aldrich). qRT-PCR was performed on a CFX96 Real-Time System (Bio-Rad ...
-
bioRxiv - Genomics 2022Quote: ... The RevT primers (Table S1, Sigma) were dissolved in ultrapure water at a concentration of 100 μM and mixed at this concentration.
-
bioRxiv - Synthetic Biology 2022Quote: ... Primers were synthesized by Sigma-Aldrich (see Table S2 and S3 ...
-
bioRxiv - Genomics 2022Quote: ... Primers were purchased from Sigma-Aldrich. Probes sequences are listed in Supplementary Table 6 ...
-
bioRxiv - Neuroscience 2023Quote: ... and following specific primers (Sigma-Aldrich) (Table S6).Reactions were conducted in triplicate using StepOnePlus™ Real-Time PCR System (Applied Biosystems® ...