Labshake search
Citations for Millipore Sigma :
201 - 250 of 289 citations for Universal TT epitope P2 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative PCR was performed using FastStart Universal SYBR Green Master Mix (Sigma, 4913850001). The aggregates of three housekeeping genes (B2m ...
-
bioRxiv - Neuroscience 2023Quote: ... the blot was probed for HA-epitope (rabbit anti-HA, Cell Signaling #3724, 1:1000; or rat anti-HA, Sigma #11867423001, 1:1000), or PSD95 (mouse anti-PSD95 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 µM of MISSION® siRNA Universal Negative Control (Sigma-Aldrich; catalog no. SIC001) was used as a “non-targeting” control in our experiments ...
-
bioRxiv - Genomics 2019Quote: ... we used CpGenome™ Universal Methylated and Unmethylated DNA (Chemicon, Millipore, Billerica, MA, USA), respectively ...
-
bioRxiv - Cancer Biology 2019Quote: ... FastStart Universal SYBR Green Master (Sigma, 04 913 850 001, St. Louis, MO, USA). Signals were detected by StepOnePlus real-time PCR system (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... Mission siRNA and universal negative control #1 was from Sigma-Aldrich (St. Louis, MO). Mitomycin C (MMC ...
-
bioRxiv - Microbiology 2021Quote: ... cecal contents were homogenized with universal pre-enrichment broth (Sigma-Aldrich, Oakville, ON, Canada) and incubated aerobically at 35°C for 24 h ...
-
bioRxiv - Microbiology 2021Quote: ... The scramble siRNA controls used were universal siCTRL1 (SIC001) and siCTRL2 (SIC002) (Sigma-Aldrich) and the sequences of the siRNAs targeting DDX42 were siDDX42-1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 10 µM of MISSION® siRNA Universal Negative Control (Sigma-Aldrich; catalog no. SIC001) was used as a “non-targeting” control in our experiments ...
-
bioRxiv - Bioengineering 2020Quote: ... Universal Proteomics Standard 2 (UPS2) and Urea were purchased from Sigma (St. Louis, MO). Trypsin was purchased from Promega (Madison ...
-
bioRxiv - Cell Biology 2022Quote: ... while for experimental control MISSION® siRNA Universal Negative Control (both from Sigma Aldrich) was used at a concentration of 30 nm each ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative RT-PCR was performed using FastStart Universal SYBR Green Master (Rox) (Sigma, 4913850001) on a Bio-Rad CFX Connect Real-Time PCR detection system ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 µM of MISSION® siRNA Universal Negative Control (Sigma-Aldrich; catalog no. SIC001) was used as a “non-targeting” control in our experiments ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 μM of MISSION® siRNA Universal Negative Control (Sigma-Aldrich; catalog no. SIC001) was used as a “non-targeting” control in our experiments ...
-
bioRxiv - Cancer Biology 2023Quote: ... as a negative control we used siRNA Universal Negative Control #1 (SIC001, Sigma-Aldrich). Cells were plated onto 6-well plate for western blot or on glass coverslips for confocal microscopy ...
-
bioRxiv - Molecular Biology 2024Quote: ... to generate cDNA and performed qPCR using FastStart Universal SYBR Green Master (Sigma Aldrich). We used primers against Citrine (CGGCGACGTAAACGGCCACAAGTTCAG ...
-
bioRxiv - Molecular Biology 2020Quote: ChIPs were performed on plasmid shuffled derivatives of KY3232 as described above with an antibody against the FLAG epitope (Sigma-Aldrich, 30 µL A2220) to immunoprecipitate FLAG-Rpb3 ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-amyloid precursor protein (APP; mouse anti-human monoclonal antibody clone 22c11, dilution 1:10, epitope retrieval time 10 min, MAB348; EMD Millipore, Burlington, MA, USA); anti-glial fibrillary acidic protein (GFAP ...
-
bioRxiv - Cell Biology 2024Quote: ... and rabbit polyclonal anti-β-actin antibody (catalog number A2066, epitope: amino acids 365-375 of human β-actin) were obtained from Sigma (Madrid, Spain). Mouse monoclonal Anti-GOK/STIM1 antibody (Clone 44/GOK ...
-
bioRxiv - Molecular Biology 2021Quote: ... were prepared by extraction with trichloroacetic acid (TCA) and subjected to Western blot analysis as described previously (13) using antibody against the His6 epitope (EMD Millipore/Novagen 70796, 1:2000 dilution) Experiments were repeated three or more times from Biological replicates.
-
bioRxiv - Molecular Biology 2022Quote: Antibodies that recognize the following proteins and epitope tags were used: glucose-6-phosphate dehydrogenase (G6PDH; Sigma-Aldrich A-9521, 1:20,000 or 1:50,000), H2B (Active motif 39237 ...
-
bioRxiv - Cell Biology 2019Quote: ... siRNA duplexes were used at the following concentrations: siRNA Universal Negative Control #1 (Sigma-Aldrich) and Mic10 (5’-CGGAUGCGGUCGUGAAGAUtt-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... Mission siRNA universal negative control #1 was used for all negative controls (SIC001-1NMOL; Sigma). All siRNAs were used at a final concentration of 25 nM ...
-
bioRxiv - Cell Biology 2021Quote: ... with siRNAs (SASI_Hs01_00180215 for Set8, SASI_Hs02_00348728 for Suv420h1, and Universal Negative Control #1, Sigma-Aldrich) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... Mission siRNA universal negative control #1 was used for all negative controls (SIC001-1NMOL; Sigma). All siRNAs were used at a final concentration of 25 nM ...
-
bioRxiv - Systems Biology 2020Quote: RT-qPCR was carried out using FastStart Universal SYBR Green Master Mix (Rox) (Sigma Aldrich) in an Applied Biosystems QuantStudio 6 ...
-
bioRxiv - Genomics 2019Quote: ... We performed qRT-PCR using FastStart Universal SYBR Green Master Mix with ROX (Sigma, 4913914001) on a ViiA 7 Real-Time PCR System (Thermo Fisher) ...
-
bioRxiv - Microbiology 2019Quote: ... Cells not subjected to knockdown were transfected with MISSION siRNA Universal Negative Control #1 (Sigma) at equivalent concentrations.
-
bioRxiv - Immunology 2021Quote: ... The mammalian universal Type I interferon (IFN-αA/D) was procured commercially (Sigma-Aldrich; I4401) and recombinant murine IFN-λ2 was purchased from Peprotech (Catalog # 250-33).
-
bioRxiv - Cancer Biology 2022Quote: ... using gene-specific primers (Table S2) and FastStart Universal SYBR Green master mix (Millipore-Sigma). Reactions were run in duplicate and relative Ct values were normalized and calculated independently using the –ΔΔ Ct method for the expression of the housekeeping genes HPRT1 and RPL13A (all primers are listed in Table S1).
-
bioRxiv - Cancer Biology 2022Quote: ... using gene-specific primers (Table S2) and FastStart Universal SYBR Green master mix (Millipore-Sigma). Reactions were run in duplicate and relative Ct values were normalized and calculated independently using the –ΔΔ Ct method for the expression of the housekeeping genes HPRT1 and RPL13A (all primers are listed in Table S1).
-
bioRxiv - Microbiology 2023Quote: ... The qPCR assay was performed with the Universal KAPA SYBR FAST qPCR kit (Sigma Aldrich) on an Applied Biosystems 7500 Fast Real-Time PCR desktop system (Applied Biosystems ...
-
bioRxiv - Microbiology 2023Quote: ... This qPCR assay was performed with the Universal KAPA SYBR FAST qPCR kit (Sigma Aldrick) on the ABI 7500 Fast Real-Time PCR desktop system (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2021Quote: ... were prepared by extraction with trichloroacetic acid (TCA) and subjected to Western blot analysis as described previously (13) using antibody against the His6 epitope (EMD Millipore/Novagen 70796, 1:2000 dilution) Experiments were repeated three or more times from Biological replicates.
-
bioRxiv - Molecular Biology 2019Quote: ... Xist and Gapdh RNA expression was performed using FS Universal SYBR Green Master (Rox) (Sigma-Aldrich) according to manufacturer’s instructions under the following conditions ...
-
bioRxiv - Molecular Biology 2021Quote: ... b) PEI only without Bgpiwi siRNAs and c) Mission Universal mock siRNA/PEI complexes (Sigma Millipore). RNA was isolated as described above from washed transfected snails before utilizing for qPCR as described above ...
-
bioRxiv - Molecular Biology 2021Quote: ... b) PEI only without Bgpiwi siRNAs and c) Mission Universal mock siRNA/PEI complexes (Sigma Millipore). RNA was isolated as described above from washed transfected snails before utilizing for qPCR as described above ...
-
bioRxiv - Cancer Biology 2020Quote: ... followed by RT-qPCR with the FastStart Universal SYBR Green Master (Sigma-Aldrich, Cat No. 4913850001). Primers are listed in Supplementary Table 2 ...
-
bioRxiv - Immunology 2019Quote: ... 1 × 106 of HeLa cells were transfected with 50 nM of siRNA universal control (Sigma Aldrich) or siRNA specific for viperin (SASI_Hs02_00362416 ...
-
bioRxiv - Cell Biology 2019Quote: ... The control group was treated with Mission siRNA Universal Negative Control # 1 (Cat# SIC001, Sigma-Aldrich). Gene silencing was done based on a previously published protocol (26 ...
-
bioRxiv - Microbiology 2020Quote: ... hAEC cultures were pretreated with recombinant universal type I IFN (100 or 10 IU/ml; Sigma) or recombinant IFN-λ3 (100 or 10 ng/ml 56 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and an siRNA Universal Negative Control were purchased from MISSION® Predesigned siRNA libraries (Sigma-Aldrich). Cells were transfected using JetPRIME transfection reagents (PolyPlus ...
-
bioRxiv - Molecular Biology 2023Quote: The enzymatic activity of the TaSnRK1α was assessed using the Universal Fluorometric Kinase Assay Kit (Sigma). For kinase assay ...
-
bioRxiv - Cancer Biology 2023Quote: ... For LISR KD either control (MISSION® siRNA Universal Negative Control #1 and #2, Sigma Aldrich) or siLISR (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... with siRNAs (SASI_Hs01_00069342 for Orc6, SASI_Hs01_00038888 for Orc1, SASI_Hs02_00341067 for Orc2, and Universal Negative Control #1, Sigma-Aldrich; s11403 for PSMD7 ...
-
bioRxiv - Genetics 2024Quote: ... RT-qPCR was performed using KAPA SYBR® FAST qPCR Master Mix (2X) Universal (Sigma-Aldrich) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... and IFN-α1 cytokines were performed using KAPA SYBR fast universal qPCR kit (Sigma-Aldrich, USA) on QuantStudio real-time PCR system (Applied Biosystems ...
-
bioRxiv - Genomics 2021Quote: ... Fold change in gene expression (ΔΔct method) was evaluated by qPCR (iTaq universal SYBR Green Supermix) (Sigma), performed in CFX96RTS thermal cycler (Bio-Rad) ...
-
bioRxiv - Microbiology 2021Quote: ... The non-targeting control siRNAs (MISSION siRNA Universal Negative Control #1, SIC001) were purchased from Sigma Aldrich.
-
bioRxiv - Molecular Biology 2020Quote: ... The non-targeting control siRNAs (MISSION siRNA Universal Negative Control #1, SIC001) were purchased from Sigma Aldrich.