Labshake search
Citations for Millipore Sigma :
351 - 400 of 10000+ citations for TROP 2 Human 248a.a HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... pH = 7.6) containing 0.01% Triton X-100 (TBS-T) and then blocked with 2% human serum albumin (HSA; Sigma-Aldrich) and 10% NGS in TBS-T for 30 min ...
-
bioRxiv - Immunology 2021Quote: ... The albumin analyte was selected and measured using MILLIPLEX MAP Human Kidney Injury Magnetic Bead Panel 2 (Millipore Sigma) following manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: Human serum albumin (fraction V) 98% and 5,5’-dithiobis-2-nitrobenzoic acid (DTNB) were purchased from Sigma Aldrich (USA) and used without any prior purification ...
-
bioRxiv - Biochemistry 2023Quote: ... Mouse primary cortical cultures were then treated with 0.5 μg/ml human recombinant tissue inhibitor of metalloproteinase-2 (TIMP2, Sigma) for one biological replicate or 10 μM BB94 for two biological replicates ...
-
bioRxiv - Immunology 2024Quote: ... which after solidification were overlayed by basal medium containing Advanced DMEM/F12 + 1:100 Glutamax + 10 mM HEPES + 1.25 mM N-AcetylCystein + 1:50 B-27 Supplement + 1:100 N-2 Supplement + 50 ng/ml human EGF + 1:500 Primocin + 0.002% Heparin (Sigma), supplemented with additional factors as described in the main text ...
-
Molecular basis of proteolytic cleavage regulation by the extracellular matrix receptor dystroglycanbioRxiv - Biochemistry 2024Quote: Recombinant human MMP-2 (R&D) and MMP-9 (R&D) were activated using p-aminophenylmercuric acetate (APMA, Sigma) in MMP assay buffer (50 mM Tris (Fisher) ...
-
bioRxiv - Biochemistry 2022Quote: ... as a His-tag fusion and Ars2206-531 into pRSFduet vector (Novagen) as a Strep-tag fusion ...
-
bioRxiv - Molecular Biology 2019Quote: ... Monoclonal anti-His and anti-Flag antibodies were obtained from Sigma Aldrich, St ...
-
bioRxiv - Microbiology 2019Quote: ... The supernatant was mixed with Ni2+-NTA His•Bind resin (EMD Millipore) equilibrated with Buffer G and allowed to go overnight at 4 °C ...
-
bioRxiv - Microbiology 2019Quote: ... The supernatant was mixed with Ni2+-NTA His•Bind resin (EMD Millipore) equilibrated with Lysis/Binding Buffer (50 mM Na2HPO4 ...
-
bioRxiv - Microbiology 2020Quote: ... and proteins were purified over HIS-Select (Sigma–Aldrich, St. Louis, MO) nickel affinity resin in 20 mM Tris (pH 8.0 ...
-
bioRxiv - Microbiology 2020Quote: ... 10 % heat-inactivated fetal bovine serum (HI-FBS) (v/v) (Sigma-Aldrich), and 1 % antibiotic-antimycotic (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... The supernatant was loaded onto His-Select Nickel Affinity Gel (Sigma-Aldrich) equilibrated with buffer A (25 mM Tris–HCl ...
-
bioRxiv - Biochemistry 2021Quote: ... Bound protein was detected using anti-His-HRP conjugate (Sigma; 1:10,000). All proteins and antibodies were in 0.1 M phosphate buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... The β-Spectrin-His construct was transformed into BL21(DE3) cells (Novagen) and induced for protein expression with 0.5mM IPTG (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: 30µL/well of rabbit anti-His tag antibody (Sigma Aldrich, catalog #SAB5600227) was adsorbed at a concentration of 0.5 μg/mL on to 384 well microplates (Thermofisher ...
-
bioRxiv - Bioengineering 2022Quote: ... Pre-cleared supernatant was mixed with Ni-NTA His-Bind Resin (Novagen) (Pajenda et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... His6-tagged proteins were purified with Ni-NTA His-Bind Superflow (Novagen) and dialyzed against PBS using a Pur-A-Lyzer™ Midi Dialysis Kit (Merck).
-
bioRxiv - Immunology 2020Quote: ... supplemented with 15% FBS HI (Life Tehnologies) + 1% Pen/Strept (Sigma-Aldrich), 1% L-glutamine (Life Technologies) ...
-
bioRxiv - Immunology 2022Quote: The recombinant proteins were purified using His•Bind® Purification Kit (Novagen) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... Purification of rcCBP2 was performed by HIS-Select HF Nickel Affinity (Sigma) and gel permeation chromatography on Superdex 75 column (GE Healthcare Life Sciences) ...
-
bioRxiv - Cell Biology 2019Quote: ... for 10 minutes followed by anti-his antibody (Sigma, Cat. No. 11922416001) for another 10 mins ...
-
bioRxiv - Microbiology 2021Quote: ... The crude lysate rocked with HIS-select nickel affinity gel resin (Sigma) for 45 min at 4 °C ...
-
bioRxiv - Biochemistry 2021Quote: ... the supernatant was loaded onto a His-bind resin column (Merck Millipore) (1 ml ...
-
bioRxiv - Plant Biology 2023Quote: ... The membrane was probed with 1:10000 anti-His antibody (Sigma, USA) followed by 1:20000 anti-mouse antibody (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: His-tagged recombinant proteins were expressed in Rosetta2 (DE3)pLysS bacteria (Novagen) and purified on IMAC columns (Bio-Rad ...
-
bioRxiv - Biochemistry 2023Quote: ... The His-tag of the eluted protein was cleaved by thrombin (Sigma), incubated at 4 °C overnight ...
-
bioRxiv - Biophysics 2023Quote: ... His-Clathrin was labeled with Atto594 NHS-ester (ATTO-TEC, Sigma-Aldrich) according to a previously published protocol (41 ...
-
bioRxiv - Plant Biology 2023Quote: ... in-frame of the C-terminal (His)6-tag (Novagen, http://www.emdbiosciences.com) resulting in pET28a:ApTPS1 ...
-
bioRxiv - Biophysics 2023Quote: ... then incubated with mouse anti-His tag primary antibody (Millipore Sigma SAB1305538) at 1:1,000 dilution ...
-
bioRxiv - Plant Biology 2024Quote: ... and confirmed by Western blotting using His-tag antibody (Sigma; SAB 1305538). The His-tagged GUN1-PS protein was produced essentially as described (19) ...
-
bioRxiv - Bioengineering 2024Quote: ... supplemented with 10% heat-inactivated fetal bovine serum (HI-FBS) (Sigma Aldrich) at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... and 5% Fetal bovine serum (FBS; Sigma Heat Inactivated, US/HI origin). PBMCs were cultured overnight in chemotaxis media containing RPMI and 1% ultrapure BSA prior to use in assays.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... or human liver microsomes (HLMs) (male human pooled, Sigma-Aldrich), respectively ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human haemoglobin (Sigma) was used for creation of standard curve.
-
bioRxiv - Microbiology 2021Quote: ... human insulin (Sigma), 10’000 units/ml of penicillin and 10’000 µg/ml streptomycin (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... human HDL (Millipore), human LDLs (Millipore ...
-
bioRxiv - Microbiology 2021Quote: ... human LDLs (Millipore) or an in vitro reconstituted NS1-HDL mix were analyzed by size exclusion chromatography on a Superdex 200 10/300 column (GE healthcare) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Human hemoglobin (Sigma) was dissolved in PBS to 10 mg/mL or 1 mg/mL ...
-
bioRxiv - Microbiology 2023Quote: ... Human DPP4 (Sigma) was used as a control in PBS at 50 ng/μL (0.585 μM) ...
-
bioRxiv - Cell Biology 2020Quote: Caco-2 (human epithelial colorectal adenocarcinoma cell line) cells were purchased from ATCC and cultured in DMEM high glucose media (Sigma). The cells were trypsinized using 0.25% trypsin-EDTA and resuspended in the fresh media ...
-
bioRxiv - Immunology 2021Quote: ... the following components were added: 2 mM L-Glutamine (Fisher), 10% heat-inactivated (56°C, 60 min) human AB serum (Sigma), 12.5 mM HEPES (Fisher) ...
-
bioRxiv - Immunology 2020Quote: ... from 1:50 to 1:51200 in PBS containing 2% skimmed milk were added followed by ALP-conjugated anti-human IgG (A9544; Sigma) at 1:10,000 dilution ...
-
bioRxiv - Bioengineering 2021Quote: ... and 1,500 mg/L sodium bicarbonate (ATCC) supplemented with 2 ng/ml recombinant human Granulocyte-Macrophage Colony-Stimulating Factor (Sigma-Aldrich) and 10 % fetal bovine serum ...
-
bioRxiv - Microbiology 2019Quote: ... the slides were incubated for 2 hours at room temperature with 1 µg/mL Cy3-conjugated goat anti-human IgG (H+L) (Sigma) and washed again ...
-
bioRxiv - Cancer Biology 2020Quote: ... Concentrations of 29 cytokines/chemokines were measured in 2-4 biological replicates using MILLIPLEX Map Human Cytokine/Chemokine Magnetic Bead Panel (HCYTMAG-60K-PX29, #Millipore) according to manufacturer’s protocol.
-
bioRxiv - Microbiology 2021Quote: ... Samples were then diluted 1:2 in serum matrix for analysis with Milliplex Non-Human Primate Magnetic Bead Panel as per manufacturer’s instructions (Millipore Corporation). Concentrations for each cytokine were determined for all samples using the Bio-Plex 200 system (BioRad Laboratories Inc.).
-
bioRxiv - Cancer Biology 2021Quote: ... Target sequences (CTTCAACGTCTCTCAACAGAT #1 and CCGAGTTCTATGAGAACGACT#2) against human CD19 and a control scrambled sequence (CTCAATCAACAGATCTCGTCT) were inserted into the pLKO.1 vector (Sigma).
-
bioRxiv - Cancer Biology 2020Quote: RH30 and RH41 cells were transfected with 100nM of human DDX5 specific siRNA (siDDX5 #1 and siDDX5 #2, Sigma-Aldrich) or scrambled control siRNA (siCTR ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were washed then sequentially incubated with anti-SARS-CoV-2 CR3022 antibody (Yuan et al., 2020) (1 μg/mL) and a HRP-conjugated goat anti-human IgG (Sigma) in PBS supplemented with 0.1% (w/v ...