Labshake search
Citations for Millipore Sigma :
201 - 250 of 10000+ citations for Sheep Anti CMV Pentamer since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... HeLa cells were transfected with U6-gDNA (5’-AAAGACGTCCCTAACAAGT-3’; clone ID es: HSPD0000063884): CMV-eCas9-2a-tGFP (Sigma-Aldrich). 48h after transfection ...
-
bioRxiv - Microbiology 2024Quote: ... and 600 ng of a wt ORF57 (pVM7) expression vector or an empty FLAG control vector (pFLAG-CMV-5.1, Millipore Sigma). After 24 h of transfection ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cytosolic expression of GFP or tdTomato was achieved by transduction with plKO.1-puro-CMV-TurboGFP (SHC003, Sigma- Aldrich, USA) or cytoplasmic tdTomato (LeGo-T2 ...
-
bioRxiv - Neuroscience 2022Quote: ... 5-16-day old females were fed sheep blood supplemented with 2 mM adenosine 5’-triphosphate (ATP) (Sigma Aldrich, A6419) in aqueous sodium bicarbonate buffer using a new artificial membrane feeder called the blood puck ...
-
bioRxiv - Developmental Biology 2022Quote: ... washed in PBS with 0.1% Triton X-100 (PBTr) and blocked with the addition of 10% sheep serum (Sigma Aldrich). Primary antibodies used were ...
-
bioRxiv - Neuroscience 2022Quote: ... sections were washed with TBST wash buffer (10% Tween20 in 1xTBS buffer) and incubated in 10% sheep serum (Sigma Aldrich) in TBS-1%BSA (Sigma Aldrich) ...
-
bioRxiv - Cell Biology 2021Quote: ... The cyclin D1-Flag plasmid was generated by PCR insertion of cyclinD1 into the p3XFLAG-CMV™-14 expression vector (Sigma). The XPack-GFP plasmid was generated by inserting GFP from pEGFP-N1 (BD Biosciences Clontech ...
-
bioRxiv - Cell Biology 2022Quote: ... pLKO.1-puro-CMV-tGFP plasmids targeting SNX5 (5’-ACTATTACAATAGGATCAAAG-3’, 5’-CTGAGTATCTCGCTGTGTTTA-3’) and SNX6 (5’-AGTAAAGGATGTAGATGATTT-3’, 5’-GCCGAAACTTCCCAACAATTA-3’) (Sigma-Aldrich) were lentivirally transduced ...
-
bioRxiv - Cell Biology 2022Quote: ... 3xFLAG-Lc3b was made by cloning the Lc3b sequence into the HindIII and KpnI sites of the vector p3xFLAG-CMV-10 (Sigma Aldrich). mCherry-Lc3b and GFP-Lc3b were made by cloning Lc3b into the EcoRI and BamHI sites of pEGFP-C1 (Clontech Laboratories ...
-
Differential turnover of Nup188 controls its levels at centrosomes and role in centriole duplicationbioRxiv - Cell Biology 2019Quote: ... To construct pKD1 the NUP188 coding sequence was amplified by PCR and subcloned into p3XFLAG-CMV™-10 vector (Millipore Sigma) using the Gibson Assembly® Master Mix (NEB ...
-
bioRxiv - Cell Biology 2021Quote: ... Human full length SPAG5 ORF (ATG1-SPAG5) or excluding the first 453 nucleotides (Δ151-SPAG5) were cloned into p3xFLAG-CMV-14 (Sigma-Aldrich) using NotI or NotI/ClaI restriction sites ...
-
bioRxiv - Cancer Biology 2020Quote: ... PRL-3 over expressing construct was made by cloning full length PRL-3 cDNA into p3XFLAG-CMV-14 expression vector (Sigma, E7908)
-
bioRxiv - Biochemistry 2022Quote: ... The C4A mutation was introduced by PCR amplification of the CAPN5 cDNA using an upstream primer that contained the mutation and inserting the amplification product between the EcoRI and XbaI sites of p3×FLAG-CMV-14 (Sigma, E4901). The C20A ...
-
bioRxiv - Bioengineering 2020Quote: ... 16 hours post transfection gene expression from the human CMV immediate-early gene enhancer/promoter was induced with 10 mM sodium butyrate (Sigma-Aldrich) for 6 hours before fresh media was added to the cells ...
-
bioRxiv - Molecular Biology 2020Quote: The 3×Flag-CPEB3 plasmid was generated by subcloning the PCR-amplified human CPEB3 cDNA into the p3×FLAG-CMV 10 vector (Sigma-Aldrich). The human CPEB3 cDNA was synthesized using the indicated primers ...
-
bioRxiv - Biochemistry 2020Quote: ... myoblasts were transfected at 60% confluency with DNA constructs expressing CMV-Cas9(D10A) and paired U6-gRNAs (5’-GTTGTTGCTGTCTTTCCCCAGG and 5’- ACCCCCGCTTCAACGCCCATGG) (Sigma Aldrich) using TransIT-X2 reagent (Mirus Bio) ...
-
bioRxiv - Microbiology 2021Quote: ... Flag- and HA-tagged wide-type and truncates of DDX21 (1-125, 127-784, Δ1-216, Δ574-784) were constructed by inserting indicated sequences into p3XFLAG-CMV-14 (Sigma-Aldrich) and pCMV-HA (Promega) ...
-
bioRxiv - Cell Biology 2021Quote: ... FLAG-NFAT5-PEPCK constructs (FLAG-NFAT5132-264PEPCK and NFAT5198-217PEPCK) were constructed by in-frame insertion of the corresponding NFAT5 and PEPCK into pFLAG-CMV-2 (Sigma-Aldrich) mammalian expression vector (Sigma) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Both HCC1954WT and HCC1954KO cells were transduced with the pLenti CMV Puro LUC reporter vector at MOI = 5 in the presence of 8 μg/mL of Polybrene (Sigma-Aldrich). Infected cells were selected by puromycin (2.5 μg/mL for 72h ...
-
bioRxiv - Neuroscience 2022Quote: ... samples were incubated in L-Cry antibodies 5E3-3E6-E8 (1:100) and 4D4-3E12-E7 (1:50) in 5% sheep serum (Sigma-Aldrich). Secondary antibody ...
-
bioRxiv - Neuroscience 2021Quote: ... in a mixture of two monoclonal antibodies against L-Cry, 5E3-3E6-E8 and 4D4-3E12-E7 (1:100 and 1:50, correspondingly, in 5% sheep serum (Sigma-Aldrich)) (see accompanying manuscript for further details) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Embryos after in situ HCR were washed with PBST and soaked in blocking solution [5% heat inactivated (56°C, 30 min) sheep serum (S2263, Sigma-Aldrich) in PBST] at room temperature for 2 hours ...
-
bioRxiv - Molecular Biology 2021Quote: ... generated an amplicon which was eventually cleaved with HindIII and BamHI and inserted into the same sites of p3XFLAG-Myc-CMV™-24 Expression Vector (E9283, Sigma-Aldrich) to create p3XFlag SUMO2 encoding a 3XFlag SUMO2 fusion protein ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were kindly gifted by Dr Simon Langdon (University of Edinburgh, Edinburgh, UK) and labelled with GFP (pLKO.1-Neo-CMV-tGFP vector from Sigma-Aldrich, USA) to enable their identification within the 3D organotypic model ...
-
bioRxiv - Neuroscience 2019Quote: ... Sections were washed in phosphate buffer saline with 0.5% Triton-x (PBST) and incubated with 20% heat-inactivated normal sheep serum in PBST for 2 hours (NSS; Sigma-Aldrich, Corp.). Primary antibodies were applied overnight at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... UK) supplemented with 5% Defibrinated Sheep Blood (SR0051E, Oxoid, UK) with a cotton swab before placing Optochin disks (74042, Sigma-Aldrich, Germany) on the center of the plates and incubated at 37°C under microaerophillic conditions i.e ...
-
bioRxiv - Cell Biology 2024Quote: ... The PCR products were purified and used for one-step isothermal assembly with EcoRV-digested pFLAG-CMV-5.1 (Sigma, St. Louis, MO, USA)32.
-
bioRxiv - Developmental Biology 2020Quote: ... 0.1% Triton X-100) at room temperature and blocked in KTBT + 20% sheep serum + 2% Blocking Reagent (11096176001, Sigma-Aldrich, St. Louis, MO) for 4 h ...
-
bioRxiv - Developmental Biology 2019Quote: ... 0.1% Triton X-100) at room temperature and blocked in KTBT + 20% sheep serum + 2% Blocking Reagent (11096176001, Sigma-Aldrich, St. Louis, MO) for 4 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... were incubated at 37 °C for 15 minutes with HYase (5 mg/mL; HYase type II from sheep testes, Sigma– Aldrich, St. Louis, USA) while vortexing every 5 minutes ...
-
bioRxiv - Cancer Biology 2020Quote: ... On this plasmid a single primer PCR with primer 5’-GCA AGC CCT GAA AGC GCA AG-3’ and the cDNA human HIF-1α in a p3XFLAG-CMV™-10 expression vector (Sigma, St Louis, MO, USA) (Gort et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... PDGCLs were lentivirally transduced with the MISSION® shRNA vector pLKO.1-puro-CMV-Turbo green fluorescent protein (TurboGFP)_shnon-target (#SHC016, Sigma, part of Merck, Darmstadt, Germany) for cytosolic TurboGFP expression ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The chromatin was incubated with an anti-histone PTM antibody (anti-H4K20me3, anti-H3K4me3, and anti-H3K9ac, Cell Signal Technology; anti-H3K27ac, Millipore; anti-H3K36me3, Abcam) overnight at 4°C and the immunoprecipitation carried out using Dynabeads protein A and Dynabeads protein G ...
-
bioRxiv - Cell Biology 2019Quote: ... anti-MIC27 AntI-MIC27 (Sigma, cat# HPA000612), anti-GAPDH (ProteinTech ...
-
bioRxiv - Physiology 2020Quote: ... anti-Actin and anti-Tubulin (Sigma-Aldrich).
-
bioRxiv - Cell Biology 2021Quote: ... anti-HA and anti-VSV-G (Sigma cat ...
-
bioRxiv - Cancer Biology 2023Quote: Anti-Rabbit IgG/Anti-mouse IgG (Millipore) was used for isotype control.
-
bioRxiv - Cancer Biology 2024Quote: ... 1% v/v Anti-anti (Sigma, USA), 2% v/v Gem21 NeuroPlex™ Serum-Free (without Vitamin A ...
-
bioRxiv - Cancer Biology 2024Quote: ... anti-FLAG-M2 and anti-ETV7 (Sigma). The rat monoclonal anti-ETV7 peptide antibody (7E4 ...
-
bioRxiv - Cell Biology 2020Quote: ... Anti-phosphotyrosine (anti-pY) clone 4G10 and anti-facilitative glucose transporter 3 (anti-GLUT3) AB1344 from Millipore (Temecula, CA, USA); anti-phospho PKA substrates (anti-pPKAs ...
-
bioRxiv - Molecular Biology 2019Quote: ... anti-MYC (Cell Singaling) or anti-FLAG (Sigma) antibodies ...
-
bioRxiv - Genetics 2019Quote: ... anti-α-tubulin (1:20,000, Sigma, anti-mouse), IRDye 800CW (1:20,000 ...
-
bioRxiv - Biochemistry 2020Quote: ... anti-mouse and anti-goat IgG (Sigma-Aldrich). Antibody complexes were detected using enhanced chemiluminescence detection reagents (GE Healthcare ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-goat and anti-mouse antibodies (Sigma-Aldrich, cat ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-actin and anti-ß-tubulin from Sigma, anti-S-tag from Novagen ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-SMC3 (homemade) or anti-PAXIP1 (Sigma #ABE1877). Protein-antibody complexes were precipitated with 10µL of protein G Dynabeads (Fisher #10003D) ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-Sequestosome-1 (anti-SQSTM1/p62, Sigma, P0067), anti-phosphoinositide 3-kinase regulatory subunit 4 (anti-PIK3R4/VPS15 ...
-
Appropriate glycemic management protects the germline but not uterine environment in type 1 diabetesbioRxiv - Developmental Biology 2024Quote: ... anti-MCT1 (chicken anti-mouse, 1:200, Sigma) and anti-pimonidazole conjugated with red fluorophore (mouse anti-pimonidazole ...
-
bioRxiv - Cancer Biology 2021Quote: ... A2547), anti-VCAN (polyclonal, HPA004726), anti-COL11A1 (polyclonal, HPA052246), anti-COL1A1 (polyclonal, HPA011795), anti-FN1 (polyclonal, F3648) all from Sigma-Aldrich, UK ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary antibodies (anti-γH2A.X #2577s – Cell Signalling Technology, anti-nephrin #GP-N2 – Progen, anti-synaptopodin #65294 – Progen, anti-Dach1 #HPA012672 – Sigma Aldrich (43), anti-phospho-S6 Ribosomal Protein (Ser235/236 ...