Labshake search
Citations for Millipore Sigma :
1 - 50 of 3653 citations for Recombinant Human USP7 None tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... was incubated with recombinant His-tagged human HDAC6 protein (EMD Millipore) in 250 μl RB100 buffer (25 mM HEPES pH 7.5 ...
-
bioRxiv - Cell Biology 2019Quote: The shRNAs targeting USP7 (Sigma), EZH2 ...
-
bioRxiv - Cell Biology 2023Quote: 2 μg GST-tagged NuSAP point mutants were incubated with 50 ng human recombinant Aurora A (Sigma-Aldrich) in a water bath at 30°C for 30 min in kinase buffer (50 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... 6×His-tagged recombinant MSP1E3D1 (Sigma-Aldrich, Merck, USA) and FLAG-tagged recombinant mCardinal (kindly provided by Jakub Czapiński ...
-
bioRxiv - Neuroscience 2021Quote: ... recombinant human apoE4 (Sigma), and ThT (Sigma ...
-
bioRxiv - Bioengineering 2023Quote: ... human recombinant LIF (Millipore), and Heparin (StemCell Technologies) ...
-
bioRxiv - Cell Biology 2021Quote: ... USP7 (5’CCCAAAUUAUUCCGCGGCAAA3’ from Sigma-Aldrich), the coding sequence of Chk1 (5’GAAGCAGUCGCAGUGAAGA3’ from Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-S18 phosphorylated USP7 (ABC225, Merck-Millipore), anti-S18 non-phosphorylated USP7 (ABC226 ...
-
bioRxiv - Microbiology 2022Quote: ... 10nM recombinant human gastrin (Sigma), 50ng/mL EGF (Peprotech) ...
-
bioRxiv - Microbiology 2022Quote: ... 10nM recombinant human gastrin (Sigma), 50ng/mL EGF (Peprotech) ...
-
bioRxiv - Microbiology 2022Quote: ... the mixture was subsequently transferred to sterile none-siliconized 2 ml tubes (Sigma) with neutrophils (1 × 107 cells ...
-
bioRxiv - Plant Biology 2019Quote: ... His-tagged recombinant protein was eluded with 250 mM imidazole (Sigma).
-
bioRxiv - Neuroscience 2019Quote: ... and His-tagged human HDAC6 protein (EMD Millipore) were incubated with 57 nm 32P-ATP in kinase buffer (50 mM Tris HCl ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-S18 non-phosphorylated USP7 (ABC226, Merck-Millipore), anti-USP11 (A301-613A ...
-
bioRxiv - Cancer Biology 2023Quote: ... The USP7 inhibitors P5091 and P22077 (Sigma Aldrich) were administered at 10μM and 15μM respectively for 24 and 48 h time periods ...
-
bioRxiv - Neuroscience 2022Quote: ... and 1μM recombinant human insulin (Sigma). Organoids were collected from the wells on day 14 and transferred to 10cm dishes at roughly 20 organoids per dish ...
-
bioRxiv - Physiology 2022Quote: ... 500μg/ml human recombinant albumin (Sigma), 213μg/ml L-ascorbic acid (Sigma) ...
-
bioRxiv - Immunology 2020Quote: ... human recombinant TNF (H8916, Sigma-Aldrich) or chemical inhibitors (SB203580 from Selleck ...
-
bioRxiv - Neuroscience 2023Quote: ... recombinant human TNFα (Sigma Aldrich, #H8916), PGE2 (Sigma Aldrich ...
-
bioRxiv - Developmental Biology 2024Quote: ... 10nM recombinant human gastrin (Sigma; G9145), 5ng/mL recombinant human HGF (PeproTech ...
-
bioRxiv - Cell Biology 2023Quote: His-tagged recombinant proteins were expressed in Rosetta2 (DE3)pLysS bacteria (Novagen) and purified on IMAC columns (Bio-Rad ...
-
bioRxiv - Biophysics 2021Quote: PAI-1 (human recombinant, Sigma-Aldrich, Germany)
-
bioRxiv - Biophysics 2021Quote: ... PAI-1 (human recombinant, Sigma-Aldrich, Germany), Plasminogen (human plasma purified protein ...
-
bioRxiv - Cell Biology 2019Quote: ... Recombinant human thrombin (1 U/ml, Sigma) was added to the bottom of a 3.0 µm costar polycarbonate transwell membrane insert (Corning ...
-
bioRxiv - Cell Biology 2020Quote: ... sativa–derived recombinant human albumin (Sigma-Aldrich), and 213μg/ml L-ascorbic acid 2-phosphate (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: ... 10μM recombinant human Gastrin (Sigma-Aldrich G9145), 50ng/mL recombinant human HGF (Peprotech 100-39H) ...
-
bioRxiv - Developmental Biology 2019Quote: ... 10.7 μg/mL recombinant human transferrin (Sigma), and 20μg/mL recombinant human insulin (Peprotech) ...
-
bioRxiv - Biochemistry 2019Quote: Recombinant human insulin (hINS) powder (Sigma Aldrich) was dissolved in 20 mM HCl (pH 2) ...
-
bioRxiv - Neuroscience 2019Quote: ... recombinant human TNFα (30 ng/mL, Sigma), and C1q (400 ng/mL ...
-
bioRxiv - Cancer Biology 2020Quote: ... Recombinant Human Insulin (Sigma cat no. I9278) 0.02mg/mL ...
-
bioRxiv - Bioengineering 2021Quote: ... 0.002 mg/mL recombinant human insulin (Sigma), 0.1% Trace Elements A (Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 10nM recombinant human (Leu15)-gastrin I (Sigma), 50ng/ml recombinant human EGF (Peprotech) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 10nM recombinant human (Leu15)-gastrin I (Sigma), 50ng/ml recombinant human EGF (Peprotech) ...
-
bioRxiv - Bioengineering 2021Quote: ... 0.002 mg/ml recombinant human insulin (Sigma), 0.1% Trace Elements A (Fisher Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... 0.5% recombinant human serum albumin (A9986, Sigma), 25 mM HEPES pH 7.4 ...
-
bioRxiv - Neuroscience 2023Quote: ... Recombinant 2N4R human Tau (Tau441, AG960, Millipore) at serial dilutions ranging from 20 µg/ml to 0 µg/ml total tau was used to generate a calibration curve and calculate total tau in our samples.
-
bioRxiv - Cell Biology 2022Quote: ... 0.025-μg·ml-1 recombinant human EGF (Sigma), 0.1-μg·ml-1 cholera toxin (Sigma-Aldrich) ...
-
bioRxiv - Genetics 2022Quote: ... 10 μg/ml recombinant human insulin (Sigma), 2 IU/ml heparin (Sigma) ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 ng/mL human recombinant bFGF (Sigma), and 10 μM Y-27632 (STEMCELL Technologies)) ...
-
bioRxiv - Genomics 2023Quote: ... 10 μg/mL recombinant human insulin (Sigma), 2 IU/mL heparin (Sigma) ...
-
bioRxiv - Microbiology 2024Quote: ... 5 ng of recombinant human AChE (Sigma) or 30 μg of tissue lysate was incubated with steroidal alkaloid compound or at room temperature for 30 minutes in 50 mM Tris pH 8.0 in a total volume of 90 μL ...
-
bioRxiv - Microbiology 2024Quote: ... Recombinant human IFN-α2a (H6041; Sigma-Aldrich) was reconstituted in PBS with 0.1% BSA and added to the basolateral pole at a final concentration of 100 U/ml ...
-
bioRxiv - Bioengineering 2019Quote: ... 100 µg/ml human recombinant Delta-1 or human IgG (Sigma) was added ...
-
bioRxiv - Genomics 2020Quote: ... and/or 0.4μg human GST-tagged PP2A-α (Sigma, SRP5336) in the presence or absence of AZ’5576 or okadaic acid (Abcam ab120375 ...
-
bioRxiv - Cell Biology 2019Quote: ... USP7 (05-1946, for WB, IF, and IP) from Millipore; Ubiquityl-Histone H2B (K120 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 10 μg/ml recombinant human insulin (Sigma). BT474 cells were cultured in RPMI 1640 supplemented with 10% FBS ...
-
bioRxiv - Microbiology 2020Quote: ... 10 μg/ml of recombinant human insulin (Sigma), 2 IU/ml heparin (Affymetrix) ...
-
bioRxiv - Immunology 2022Quote: ... and 0.5% recombinant human serum albumin (Sigma Aldrich). Microfluidic droplets were generated as water-in-oil emulsions using a co-flow of aqueous phases ...
-
bioRxiv - Biochemistry 2020Quote: ... 10 μg/mL human recombinant insulin (Sigma Aldrich), 100 μM AAP ...
-
bioRxiv - Biochemistry 2019Quote: Recombinant human insulin was purchased from Sigma-Aldrich (Cat# I2643 ...