Labshake search
Citations for Millipore Sigma :
1 - 50 of 10000+ citations for Recombinant Human BCL2 Like 1 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... was incubated with recombinant His-tagged human HDAC6 protein (EMD Millipore) in 250 μl RB100 buffer (25 mM HEPES pH 7.5 ...
-
bioRxiv - Biophysics 2021Quote: ... 6×His-tagged recombinant MSP1E3D1 (Sigma-Aldrich, Merck, USA) and FLAG-tagged recombinant mCardinal (kindly provided by Jakub Czapiński ...
-
bioRxiv - Neuroscience 2019Quote: ... and His-tagged human HDAC6 protein (EMD Millipore) were incubated with 57 nm 32P-ATP in kinase buffer (50 mM Tris HCl ...
-
bioRxiv - Plant Biology 2019Quote: ... His-tagged recombinant protein was eluded with 250 mM imidazole (Sigma).
-
bioRxiv - Cell Biology 2023Quote: His-tagged recombinant proteins were expressed in Rosetta2 (DE3)pLysS bacteria (Novagen) and purified on IMAC columns (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... His-tagged recombinant proteins were detected using an HRP-conjugated anti-His monoclonal antibody (Sigma-Aldrich, St. Louis, MO) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... insulin-like growth factor 1 (IGF-1; 100 ng/ml; recombinant Human LONG R3 IGF-1, Sigma-Aldrich, Cat# I1271, MO, USA), rapamycin (10 ng/ml ...
-
bioRxiv - Biophysics 2021Quote: His-tagged human PCNA protein was purchased from Sigma Aldrich (catalogue number SRP5117), at a concentration of 6.6 μM ...
-
bioRxiv - Immunology 2023Quote: ... All antibodies were incubated separately at a concentration of 10 μg/ml in tubes together with 330 ng/ml HIS-tagged CD40 recombinant protein and 4 μg/ml peroxidase-coupled anti-HIS detection antibody (Sigma-Aldrich) for 60 minutes in ELISA buffer (PBS ...
-
bioRxiv - Biochemistry 2022Quote: ... and another was loaded with 10 ng of human HSP70 (His tagged human HSP70, SRP5190, Millipore Sigma), which allowed comparisons to be made among separate gels ...
-
bioRxiv - Microbiology 2023Quote: N-terminal His-tagged KtrD cloned into pRSFDuet-1 (Novagen) was overexpressed in Escherichia coli BL21 (DE3 ...
-
bioRxiv - Biochemistry 2020Quote: ... The production of the (His)6-tagged recombinant proteins was confirmed by Western analysis using mouse monoclonal α-His-horseradish peroxidase conjugated antibodies (Sigma Aldrich, USA). Imaging of the protein bands on the Western blot was conducted using the ECL kit (ThermoScientific ...
-
bioRxiv - Systems Biology 2021Quote: ... separated proteins were transferred to a PVDF membrane using a semi-dry system and His-tagged proteins (hCDKL5 and His-Neuropilin) were detected with a HRP-conjugated anti-His antibody (1:2,000, Sigma) using the Enhanced Chemiluminescence kit (ECL ...
-
bioRxiv - Cell Biology 2019Quote: ... Bcl2/Adenovirus E1B 19 kDa and protein-interacting protein 3-like (BNIP3L/NIX) from Sigma-Aldrich (St. Louis, MO, USA), perilipin (PLIN ...
-
bioRxiv - Bioengineering 2023Quote: ... recombinant insulin-like growth factor (R3-IGF) (Sigma Aldrich, #85580C), heparin (Sigma Aldrich ...
-
bioRxiv - Microbiology 2020Quote: Female BALB/c mice have been injected intraperitoneally with 700 μg recombinant His-tagged TGT protein that was emulsified in complete Freund’s adjuvant (Sigma-Aldrich). Two weeks later ...
-
bioRxiv - Microbiology 2019Quote: ... Bound His-tagged proteins were detected using HRP-conjugated anti-His antibodies (Sigma) at a 1:500 dilution ...
-
bioRxiv - Biophysics 2021Quote: PAI-1 (human recombinant, Sigma-Aldrich, Germany)
-
bioRxiv - Biophysics 2021Quote: ... PAI-1 (human recombinant, Sigma-Aldrich, Germany), Plasminogen (human plasma purified protein ...
-
bioRxiv - Cell Biology 2019Quote: ... Recombinant human thrombin (1 U/ml, Sigma) was added to the bottom of a 3.0 µm costar polycarbonate transwell membrane insert (Corning ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.025-μg·ml-1 recombinant human EGF (Sigma), 0.1-μg·ml-1 cholera toxin (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.15×106 of murine stromal cells expressing human delta like ligand 1 (Sigma) were combined with 7.5×103 of sorted and enriched KO-/- ...
-
bioRxiv - Molecular Biology 2022Quote: These His-tagged protein lysates were combined with 1 ml nickel beads (Sigma) and incubated at 4 °C/2 hours/rolling ...
-
bioRxiv - Plant Biology 2024Quote: ... His- and GST-tagged proteins were detected with anti-His (Monoclonal Anti-polyHistidine antibody, Sigma H1029, 1:5000 dilution) or anti-GST (Mouse anti-GST monoclonal antibody ...
-
bioRxiv - Molecular Biology 2020Quote: ... coli cells and large quantities of His6 tagged recombinant Nbs were purified with 1ml of HIS-Select Nickel Affinity Gel (Sigma-Aldrich) following periplasmic expression through osmotic shock ...
-
bioRxiv - Immunology 2021Quote: ... Human fibroblast like synoviocytes (HFLS) purchase from Sigma-Aldrich were cultured and maintained in synoviocytes growth medium (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2019Quote: ... 100 µg/ml human recombinant Delta-1 or human IgG (Sigma) was added ...
-
bioRxiv - Bioengineering 2020Quote: ... The eluted His-tagged RBD was then incubated with biotin-tagged HRV C3 protease (Sigma) and passed through a streptavidin-agarose column to deplete the protease and the 8XHis-SBP peptide ...
-
bioRxiv - Microbiology 2021Quote: ... HIS-tagged B subunit of Shiga toxin 1(SML0655) and Apilimod (A149227) from Sigma; rabbit anti-EEA1 (#3288) ...
-
bioRxiv - Microbiology 2021Quote: N-terminal His-tagged recombinant proteins were expressed in Rosetta™ 2(DE3) pLysS competent cells (71403; Novagen, Inc., Madison, WI, USA) by induction with 0.5 mM isopropyl β-d-1-thiogalactopyranoside at 30°C for 4 h (N ...
-
bioRxiv - Cell Biology 2023Quote: 2 μg GST-tagged NuSAP point mutants were incubated with 50 ng human recombinant Aurora A (Sigma-Aldrich) in a water bath at 30°C for 30 min in kinase buffer (50 mM Tris-HCl ...
-
bioRxiv - Bioengineering 2021Quote: ... Mature human white-like adipocytes were transfected in the presence of fresh BM-1 medium supplemented with 1% human serum (Sigma, H4522) to mimic the subcutaneous tissue environment ...
-
bioRxiv - Cell Biology 2021Quote: ... Transfection for mature human white-like adipocytes was performed in the presence of fresh BM-1 medium supplemented with 1% human serum (Sigma, H4522). Both HeLa cells and mature human white like adipocytes were transfected with LNPs at a final mRNA concentration of 1.25μg/mL ...
-
bioRxiv - Biochemistry 2023Quote: ... 25 uL of (His)6-tagged TEV-protease (Sigma-Aldrich) was added and the solution incubated overnight at 4°C.
-
bioRxiv - Neuroscience 2021Quote: ... recombinant human apoE4 (Sigma), and ThT (Sigma ...
-
bioRxiv - Bioengineering 2023Quote: ... human recombinant LIF (Millipore), and Heparin (StemCell Technologies) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Fractions containing His-tagged protein as verified by Western blot with an anti-His antibody (Sigma) were pooled and loaded onto the StrepTrap column ...
-
bioRxiv - Microbiology 2023Quote: ... Recombinant proteins were purified with His-Bind Resin and His-Bind Buffers (Merck Millipore) according to manufacturer’s protocol and stored at a concentration of 2mg/ml in elution buffer (Merck Millipore ...
-
bioRxiv - Biochemistry 2021Quote: Genes for His-tagged or Strep II-tagged nanobodies were cloned into the pET 26b vector (Novagen). The expression and purification of all His-tagged nanobodies have been described previously 12 ...
-
bioRxiv - Cell Biology 2020Quote: ... His-tagged proteins were immobilized on Ni-NTA His-Bind® Superflow™ Resin (Merck Millipore, 70691), washed and eluted in SB buffer (30 mM HEPES-NaOH pH 7.5 ...
-
bioRxiv - Developmental Biology 2019Quote: ... 6×His-tagged protein were expressed and purified by Ni-NTA His Bind Resin (Millipore 70666-3). ∼0.2 μg of GST-OsBZR1 ...
-
bioRxiv - Biochemistry 2020Quote: ... or 15 U/mg His-tagged SUMO protease (Millipore Sigma SAE0067) by overnight incubation at 4 °C ...
-
bioRxiv - Biochemistry 2021Quote: ... recombinant His-Akt1 was from EMD Millipore (#14-279); recombinant GST-mTORf (containing a 30 fragment of mTOR encoding amino acids 2144-2175 ...
-
bioRxiv - Neuroscience 2019Quote: FXR1(1-379) was expressed as His- tagged fusion protein in Rosetta (DE3) pLysS cells (Novagen) in LB medium ...
-
bioRxiv - Cancer Biology 2019Quote: ... RP(5’ACAGTTCCACAAAGGCATCC) for BCL2 (Sigma-Aldrich), FP (5’ACCTGCAGCAATACCATTGAC) ...
-
bioRxiv - Immunology 2024Quote: ... Bcl2 (Millipore Sigma; cat.#: 05-729-25UG), GAPDH (Millipore Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... 10nM recombinant human gastrin (Sigma), 50ng/mL EGF (Peprotech) ...
-
bioRxiv - Microbiology 2022Quote: ... 10nM recombinant human gastrin (Sigma), 50ng/mL EGF (Peprotech) ...
-
bioRxiv - Cell Biology 2023Quote: ... 200 ng/ml recombinant human IGF-1 (85580C, Sigma-Aldrich), and 20 ng/ml human bFGF (PHG0021 ...
-
bioRxiv - Biochemistry 2022Quote: ... His6-tagged proteins were purified with Ni-NTA His-Bind Superflow (Novagen) and dialyzed against PBS using a Pur-A-Lyzer™ Midi Dialysis Kit (Merck).