Labshake search
Citations for Millipore Sigma :
351 - 400 of 2728 citations for Peptide B since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2019Quote: ... a solution of Rhodamin B (Sigma-Aldrich) in isopropanol was prepared ...
-
bioRxiv - Microbiology 2021Quote: ... and 250 ng/mL amphotericin B (Sigma) in sterile tissue culture flasks ...
-
bioRxiv - Cancer Biology 2019Quote: ... anti-B-actin (Sigma A5441, 1:15,000).
-
bioRxiv - Plant Biology 2020Quote: ... The human [Glu1]-fibrinopeptide B (Sigma-Aldrich) at 100 fmol/μl was used as an external calibrant and lock mass acquisition was performed every 30 s ...
-
bioRxiv - Molecular Biology 2020Quote: ... or porcine skin type B G9391 (Sigma) and 0.5% Low-gelling 2-Hydroxyethyl agarose (A4018 ...
-
bioRxiv - Physiology 2020Quote: ... and 2.5 μg/mL amphotericin B (Sigma)] ...
-
bioRxiv - Neuroscience 2019Quote: ... Map2A/B (1:1000; Millipore cat# MAB378), B-III-tubulin (1:1000 ...
-
bioRxiv - Cell Biology 2019Quote: ... (B) CAGCAGUAGAUGCAUCUUACA[dTdT] and (C) SASI_Hs01_00169803 (Sigma). Cells were reverse transfected with siRNA using RNAiMax (Invitrogen ...
-
bioRxiv - Cell Biology 2019Quote: ... cytochalasin-B (Sigma-Aldrich, St. Louis, MO) was added to the cultures to block cytokinesis of proliferating lymphocytes at a final concentration of 6 μg/mL and cells were cultured for an additional 30 h (total incubation time − 54 h).
-
bioRxiv - Cancer Biology 2020Quote: ... and 500 ng/mL ionomycin b (Sigma) in RPMI 1640 medium (Gibco ...
-
bioRxiv - Microbiology 2020Quote: ... polymyxin B (Sigma-Aldrich, Vandtårnsvej, Søborg, Denmark) tobramycin ...
-
bioRxiv - Cancer Biology 2019Quote: ... mobile phase (B) of water (MilliQ, Millipore) and mobile phase (C ...
-
bioRxiv - Physiology 2020Quote: ... 0.9 mM b-NADP (Sigma Aldrich, 10128031001), and 5 mg/ml of G-6P dehydrogenase (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cytosporone B (#C2997) was purchased by Sigma and resuspended in DMSO ...
-
bioRxiv - Biochemistry 2021Quote: ... or the CelLytic B reagent (Sigma, USA) according to the manufacturers’ protocol and were stored at -80°C.
-
bioRxiv - Cancer Biology 2020Quote: ... and B-Nicotinamide Adenine Dinucleotide (Sigma-Aldrich). The region of interest (ROI ...
-
bioRxiv - Microbiology 2020Quote: ... and 0.25 μg amphotericin B/mL (Sigma). We used a multiplicity of infection (MOI ...
-
bioRxiv - Microbiology 2020Quote: ... 10 MU polymyxin B sulphate (Sigma Aldrich), 5 MU nystatin (Sigma Aldrich) ...
-
bioRxiv - Microbiology 2020Quote: ... The reference antileishmanial agents [Amphotericin B (Sigma), SAG (Pentostam) ...
-
bioRxiv - Microbiology 2020Quote: ... 8 mg/ml amphotericin B (Sigma-Aldrich), and 0.2% β-cylodextrin (Thermo Fisher) ...
-
bioRxiv - Immunology 2021Quote: ... Amphotericin B (0.1 mg/ml) (Sigma-Aldrich), and 5-flurocytosine (1 mg/ml ...
-
bioRxiv - Immunology 2021Quote: ... and LT-B (Sigma, Cat. No. E8656), PADRE peptide (AKFVAAWTLKAAA ...
-
bioRxiv - Cell Biology 2021Quote: ... alpha-tubulin (B-5-1-2, Sigma), tyrosinated tubulin (YL1/2 ...
-
bioRxiv - Genetics 2022Quote: ... 1% amphotericin B (Sigma; 250ug/mL stock)) was added to the plate and the contents dispersed ...
-
bioRxiv - Biochemistry 2022Quote: ... and 0.5 mg/mL polymyxin B (Sigma)) for 1h (room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... 15 ng/ml amphotericin B (Sigma, A2942) and 100 I.U ...
-
bioRxiv - Genomics 2022Quote: ... or anti-b-actin (Sigma-Aldrich, A2228) and bound antibodies were visualized with peroxidase-conjugated affinity-purified donkey anti-mouse or anti-rabbit IgG (Dako ...
-
bioRxiv - Immunology 2022Quote: ... or staphylococcal enterotoxin B (SEB, Sigma, S4881) at a final concentration of 10 μg/ml as positive control ...
-
bioRxiv - Immunology 2022Quote: ... b-estradiol (Sigma-Aldrich, Cat#E8875-250MG), CLI-095 (InvivoGen ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10% 2- hydroxypropyl-b-cyclodextrin (Sigma-Aldrich), 0.4% sodium chloride ...
-
bioRxiv - Immunology 2022Quote: ... Amphotericin B (1 μg/ml, Sigma-Aldrich), fibroblast growth factor (FGF ...
-
bioRxiv - Neuroscience 2022Quote: ... 2.5 µg/mL Amphotericin B (Sigma-Aldrich). Cell lines were maintained in sterile conditions in a 37°C ...
-
bioRxiv - Pathology 2023Quote: ... or Red Oligo B (DUO86010B, Sigma- Aldrich). After washing with Duolink In Situ Wash Buffer A (DUO82046 ...
-
bioRxiv - Cell Biology 2023Quote: ... bafilomycin A (Baf) (Sigma, B-1793, 100nM), diphenyleneiodonium chloride (DPI ...
-
bioRxiv - Microbiology 2023Quote: ... 200 µM or Polymyxin B (Sigma, USA) 10 µg/ml (final concentration of 0.5 µg/ml ...
-
bioRxiv - Developmental Biology 2023Quote: ... 8 nM B-estradiol (Sigma-Aldrich, E8875), 200 ng/ml progesterone (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2023Quote: ... and 0.0024 % fast violet B-salt (Sigma) mixed in distilled water ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2.5 mM b-glycerophosphate (all from Sigma) and supplemented with protease and phosphatase inhibitor tablets (both Roche Diagnostics) ...
-
bioRxiv - Immunology 2023Quote: ... 100 U/ml polymyxin B (Sigma-Aldrich), 5 mM EDTA ...
-
bioRxiv - Physiology 2023Quote: ... 33 nM Biotin (Sigma-Aldrich, B-4639), 17 nM Panthotenate (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... or 5 μm cytochalasin B (Sigma-Aldrich).
-
bioRxiv - Microbiology 2023Quote: ... IPTG (isopropyl thio-b-D-galactoside, Sigma) to a final concentration of 0.1 mM was added to the culture and incubation was continued for 2 hours.
-
bioRxiv - Microbiology 2023Quote: ... amphotericin B (Sigma-Aldrich, St. Louis MO) and micafungin (Selleck Chemicals ...
-
bioRxiv - Bioengineering 2023Quote: ... and 0.25 μg/mL amphotericin B (Sigma) in T-75 flasks (Corning) ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 mM latrunculin B (Sigma-Aldrich; #428020), or 5 mM Y27632 (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 mg/mL polymyxin B sulfate (Sigma) and benzonase (Sigma) ...
-
bioRxiv - Microbiology 2023Quote: ... coli strain B-Type VIII (Sigma-Aldrich), was added at 0.25 μg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... 250 μg/L Amphotericin B (Sigma Aldrich), 50 U/mL penicillin ...
-
bioRxiv - Cell Biology 2023Quote: ... 250 μg/L Amphotericin B (Sigma Aldrich), 50 U/mL penicillin ...
-
bioRxiv - Microbiology 2023Quote: ... Purified toxin A and B (Sigma-Aldrich) were used as standards ...