Labshake search
Citations for Millipore Sigma :
1 - 50 of 362 citations for PGK Promoter Lin28 Lentivirus since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... The CFs were incubated with PGK-dsRed lentivirus and 8 μg/mL of polybrene hexadimethrine bromide (Sigma Aldrich, USA) for 24 hours at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... Lentivirus reprogramming (Sigma, SCR5451) with an MOI of 10 was also tested in Elephas maximus endothelial and epithelial cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... or empty vector lentivirus (Sigma). The S2-013 and S2-LM7AA lines were transduced with lentivirus encoding either shRNA against ST6GAL1 (Sigma ...
-
bioRxiv - Immunology 2022Quote: ... M1 fusion promoter (20µM) (Sigma), Rapamycin (100nM ...
-
bioRxiv - Cancer Biology 2021Quote: ... lentivirus was added with polybrene (Sigma, # H9268) at 6 µg/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... or new shRNA lentivirus (GTTGTCCTTATTGGAGATTC; TRCN0000381243; Sigma), along with psPAX2 packaging and pMD2.G envelope plasmid DNA at a ratio of 4:3:1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... RD cells were transduced with shRNA control lentivirus particles or shMCU lentivirus particles with polybrene (8μg/ml) (Sigma-Aldrich Inc.). Transduced cells were selected with 1μg/ml puromycin (Sigma-Aldrich Inc. ...
-
bioRxiv - Neuroscience 2020Quote: ... lentivirus with 8 ug/mL polybrene (Sigma, H9268) was added to a plate of confluent fibroblasts and spinfected at 37°C for 30 min at 1,000xG ...
-
bioRxiv - Cell Biology 2020Quote: BBS10 shRNA lentivirus particles were purchased from Sigma (St.Louis). The sequences of the two shRNAs selected were ...
-
bioRxiv - Neuroscience 2024Quote: ... ShRNA-GJA1-puro-GFPtag lentivirus (Millipore Sigma Cat#: SHCLNV), or ShRNA-GFP-puro control lentivirus (Millipore Sigma cat# ...
-
bioRxiv - Molecular Biology 2024Quote: ... 20µL of lentivirus and 2µL of polybrene (Sigma-Aldrich) were added directly to each well and cells were centrifuged at 930 RCF for 2 hours at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... Lentivirus expressing shRNAs targeting mouse Irf7 transcripts (Irf7 shRNA1, Sigma TRCN0000077292 and Irf7 shRNA2 ...
-
bioRxiv - Neuroscience 2021Quote: ... or for a short hairpin scramble lentivirus (Control, SHC202, Sigma) both decorated with an eGFP reporter ...
-
bioRxiv - Genetics 2020Quote: ... by culturing in Lentivirus soup (with 10μg/ml polybrene [Millipore]) for 24 hours before puromycine selection (in 1μg/ml puromycine [ThermoFisher]) ...
-
bioRxiv - Molecular Biology 2023Quote: ... lentivirus particles were filtered using a 0.45 µm filter (Millipore), before being concentrated 10-fold using the Lenti-X concentrator (Takara ...
-
bioRxiv - Neuroscience 2024Quote: ... or ShRNA-GFP-puro control lentivirus (Millipore Sigma cat#: SHC005V) in Glia Media for 24 hrs ...
-
bioRxiv - Microbiology 2020Quote: ... were generated using the Mission PLKO.1 lentivirus system from Sigma. A lentivirus expressing a scrambled ...
-
bioRxiv - Cell Biology 2020Quote: ... The lentivirus plasmid vector pLKO 1-YFP was obtained from Sigma’s validated genome-wide TRC shRNA libraries (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2022Quote: Suppression of ABL1 was achieved using lentivirus-based shRNAs (Sigma Aldrich). Briefly ...
-
bioRxiv - Developmental Biology 2020Quote: ... was packaged into lentivirus by using MISSION Lentiviral Packaging Mix (Sigma). BAT inducible Cas9 cell line was then generated by transduced BAT cells with inducible Cas9 lentivirus and then selected with blasticidin (10μg/ml) ...
-
bioRxiv - Immunology 2021Quote: ... 1mL lentivirus was used to transduce A549 cells using Polybrene (Millipore). TKO (IFNAR1/IFNLR/IFNGR1 ...
-
bioRxiv - Immunology 2021Quote: ... NK92 cells were transduced with lentivirus vector pLKO-(Plasmid TRCN0000039984; Sigma), pLKO.1-puro eGFP shRNA control (Plasmid SHC005 ...
-
bioRxiv - Microbiology 2021Quote: ... The lentivirus supernatants supplemented with 5 µg/mL polybrene (Sigma-Aldrich) were added into the ddx21+/- HeLa cells ...
-
An endothelial SOX18-mevalonate pathway axis enables repurposing of statins for infantile hemangiomabioRxiv - Molecular Biology 2024Quote: HemEC (n=3) were transduced with SOX18 shRNA lentivirus (TRCN0000017450, Sigma) or an empty vector control virus (Sigma SHC001V ...
-
bioRxiv - Neuroscience 2023Quote: ... The neurons were transduced with lentivirus of MISSION TRC1-shRNA (Sigma) knocking down candidate substrates at DIV4 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and sub-cloned into a puromycin selectable lentivirus vector pLKO_SHC201 (Sigma).
-
bioRxiv - Cancer Biology 2023Quote: ... Lentivirus was concentrated using 30 kDa MWCO Amicon Ultra filters (Sigma).
-
bioRxiv - Cell Biology 2023Quote: ... driven by the CMV promoter (Millipore Sigma, Cat#SHC012). RFP labeled eEPCs were plated with monolayer and 10ng/ml of recombinant human VEGF protein (R&D System ...
-
bioRxiv - Bioengineering 2021Quote: ... We filtered the pooled lentivirus through a 0.45-μm PVDF filter (Millipore) to remove any cellular debris.
-
bioRxiv - Cell Biology 2021Quote: ... HK2 cells were infected with lentivirus using 8 μg/mL polybrene (Sigma). To select the stable clones ...
-
bioRxiv - Systems Biology 2022Quote: ... We filtered the pooled lentivirus through a 0.45-mm PVDF filter (Millipore) to remove any cellular debris ...
-
bioRxiv - Pathology 2021Quote: ... The lentiviral plasmids (LV01) and lentivirus production were obtained from Sigma-Aldrich. Cells were sorted for GFP expression by flow cytometry and maintained in puromycin (3μg/mL) ...
-
bioRxiv - Genetics 2020Quote: ... We filtered the pooled lentivirus through a 0.45-μm PVDF filter (Millipore) to remove any cellular debris ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the lentivirus was harvested and filtered through a 0.45 micron filter (Millipore) to remove any cellular debris ...
-
bioRxiv - Cell Biology 2024Quote: Elephas maximus endothelial and epithelial cells were transduced with Lentivirus (Sigma, SCR5451) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: Lentivirus expressing shRNA against mouse ATPSCKMT was produced according protocol (Sigma-Aldrich). In short ...
-
bioRxiv - Cancer Biology 2024Quote: ... lentivirus containing plasmids from either non-target short hairpin RNA (Sigma #SHC0020) or shCSPG4 (gene target NM_001897 ...
-
bioRxiv - Cancer Biology 2024Quote: ... diluted lentivirus and 8 μg /ml polybrene (Sigma-Aldrich, St.Louis, MO, USA) were added to the cells ...
-
bioRxiv - Molecular Biology 2024Quote: Cells were infected with lentivirus using 8 µg/m polybrene (Sigma Aldrich) and were subsequently selected with 2 µg/ml puromycin (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were transduced by adding lentivirus and polybrene (Sigma TR1003G, 1:1000) to the cells in suspension ...
-
bioRxiv - Molecular Biology 2020Quote: ... the lacUV5 promoter was inserted in the pCOLADuet vector (Novagen) by inverse PCR using primers pCOLA-lac-F and pCOLA-lac-R (Table 1) ...
-
bioRxiv - Genetics 2020Quote: ... gRNA was generated with T7 promoter-containing oligos (Sigma/IDT) using HiScribe™ T7 Quick High Yield RNA Synthesis Kit (NEB ...
-
bioRxiv - Genetics 2024Quote: ... For repression of the P41nmt1 promoter 15 µM thiamine (Sigma) was used ...
-
bioRxiv - Cell Biology 2024Quote: ... with an expression vector (EF1α promoter) (Sigma-Aldrich, OGS606-5U) containing the Ovis aries PRNP VRQ allele coding sequence (Genescript) ...
-
bioRxiv - Microbiology 2020Quote: ... shRNA constructs were cloned into the Mission pLKO.1 lentivirus system from Sigma. The following antibodies were used ...
-
bioRxiv - Molecular Biology 2020Quote: ... were used to generate lentivirus particles expressing PP4C-targeting shRNA obtained from Sigma: shRNA-1 (TRCN0000010737) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were infected with lentivirus supplemented with 8 μg/ml polybrene (Sigma–Aldrich) twice within 48 h and then selected with 1 μg/ml puromycin (Sangon Biotech ...
-
bioRxiv - Immunology 2020Quote: ... then 1 ml supernatant containing proper lentivirus and 5 μg/ml polybrene (Sigma) was added ...
-
bioRxiv - Cell Biology 2023Quote: ... Lentivirus was collected and concentrated using Ambion Ultra-15 centrifugal filters (Millipore, UFC910024) 72 h after transduction ...
-
bioRxiv - Cell Biology 2023Quote: ... or KD + PD lentivirus in GM containing 8 µg/ml polybrene (EMD Millipore). The virus-containing GM was replaced with regular GM at 16 hours post-infection ...