Labshake search
Citations for Millipore Sigma :
701 - 750 of 10000+ citations for PD 1 Human HEK293 mFc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 20 nM human insulin (Sigma-Aldrich), 25 nM dexamethasone ...
-
bioRxiv - Microbiology 2023Quote: ... and human (AB serum, Sigma-Aldrich) for 15 minutes at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... apo-transferrin (apo-transferrin human, Sigma), ferritin (equine spleen ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-human Tubulin (T6074, Sigma) at 1:10 000 (WB ...
-
bioRxiv - Cell Biology 2023Quote: ... Human bronchial epithelial cells (16HBE14o-, Sigma) were maintained in medium consisting of α-MEM (Sigma) ...
-
bioRxiv - Cell Biology 2023Quote: ... 5% human AB serum (Sigma-Aldrich) and 25 ng/mL IL-2 (Miltenyi Biotec) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Anti-human-CEBPα (Sigma Aldrich, HPA052734) and the secondary antibody (HPR anti-mouse ...
-
bioRxiv - Bioengineering 2023Quote: ... rabbit anti-human Oct4 (Millipore, US), and rabbit anti-human HSP90 (Santa Cruz ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% human AB serum (Sigma-Aldrich), 50 μM 2-mercaptoethanol ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-human P2RY12 (Sigma, HPA014518), rabbit anti-human PU.1 (Cell Signaling Technology ...
-
bioRxiv - Neuroscience 2024Quote: ... Insulin solution human (Sigma Aldrich, I9278);
-
bioRxiv - Biochemistry 2024Quote: ... human Glu-Fibrinopeptide B (Sigma-Aldrich) was recorded throughout the analysis for lock-mass calibration ...
-
bioRxiv - Neuroscience 2023Quote: ... recombinant human TNFα (Sigma Aldrich, #H8916), PGE2 (Sigma Aldrich ...
-
bioRxiv - Bioengineering 2024Quote: ... thrombin from human plasma (Sigma-Aldrich) and GelMA (8.7% w/v) ...
-
bioRxiv - Pathology 2024Quote: ... and 0.5mg human fibrinogen (Sigma-Aldrich) in a total volume of 100µL EHT culture media (Celo.Cardiomyocyte advanced culture media ...
-
bioRxiv - Immunology 2024Quote: Human Immunoglobulin G (IgG) (Millipore-Sigma) was fluorescently labeled with CFTM 568 maleimide dye (CF568 ...
-
bioRxiv - Immunology 2024Quote: Human Immunoglobulin G (IgG) (Millipore-Sigma) was fluorescently labeled with CFTM 568 maleimide dye (CF568 ...
-
bioRxiv - Bioengineering 2024Quote: IgG from human serum (Sigma-Aldrich) was incubated at 62°C for 30 min to induce aggregation ...
-
bioRxiv - Bioengineering 2024Quote: ... or human complement C1q (Sigma-Aldrich) were immobilized on a CM5 or C1 sensor chip (Cytiva ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 mg/mL human fibrinogen (Sigma), 10% Matrigel (Corning) ...
-
bioRxiv - Cancer Biology 2024Quote: ... raised against human ST3GAL1 (Sigma HPA040466) and ST3GAL2 (Abcam ab96028) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 10nM recombinant human gastrin (Sigma; G9145), 5ng/mL recombinant human HGF (PeproTech ...
-
bioRxiv - Microbiology 2024Quote: ... 10 % human AB serum (Sigma-Aldrich), and 10 ng/ml recombinant human macrophage colony stimulating factor (Peprotech ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5% human serum albumin (Sigma-Aldrich), 0.0002% heparin (Sigma-Aldrich) ...
-
bioRxiv - Biophysics 2023Quote: ... by overnight dialysis or using a PD-10 Column (Cytiva, Marlborough, MA) (mGluR3) and concentrated as necessary using 3K MWCO Amicon Ultra Centrifugal filters (Millipore Sigma, Darmstadt, Germany) at 10°C ...
-
bioRxiv - Biochemistry 2019Quote: ... HEK293 cells were seeded in 6-well plates (3.0 × 105 cells/well) coated with poly-L-lysine (Sigma-Aldrich, St. Louis, MO, USA) and incubated for 24 h ...
-
bioRxiv - Cell Biology 2022Quote: ... Then, wildtype HEK293 cells (ATCC, CRL-1573) were infected in regular growth medium with 5 µg/mL polybrene (Sigma-Aldrich, TR-1003-G) and the lentivirus at a multiplicity of infection of 5 viral particles per cell ...
-
bioRxiv - Bioengineering 2022Quote: Human ovarian cancer A2780 and Adriamycin resistant human ovarian cancer A2780-R cells were procured from Sigma Inc ...
-
bioRxiv - Biochemistry 2022Quote: ... and another was loaded with 10 ng of human HSP70 (His tagged human HSP70, SRP5190, Millipore Sigma), which allowed comparisons to be made among separate gels ...
-
bioRxiv - Bioengineering 2023Quote: ... 1µL thrombin from human plasma was added to 3.5µL of the cardiomyocyte- human fibrinogen mixture (Sigma-Aldrich). Then ...
-
bioRxiv - Bioengineering 2023Quote: ... 1µL thrombin from human plasma was added to 3.5µL of the cardiomyocyte-human fibrinogen mixture (Sigma-Aldrich) and 2µL of the mixture is carefully pipetted into the microwell ...
-
bioRxiv - Immunology 2020Quote: ... plasma samples were incubated at a dilution of 1:100 and bound antibodies were detected with goat anti-human IgM/HRP (Sigma: cat. A6907, 1:6’000 dilution), goat anti-human IgG/HRP (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2020Quote: HEK293-T cells were transiently transfected with GFP-V5 or GREP1-V5 fusion proteins using OptiMem and Fugene HD (Sigma-Aldrich, St. Louis, MO). 72 hours after transfection ...
-
bioRxiv - Cancer Biology 2022Quote: ... Media were collected from HEK293 cells 48 hours after transfection and used for transductions in a final concentration of 8 ug/mL polybrene (Sigma-Aldrich, cat. TR-1003). Selection and maintenance of transduced cells was achieved with 5 ug/mL puromycin (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: ... to validate the gene expression the plasmid (vide-supra) was transfected into HEK293 cells using PEI (Sigma-Aldrich/Merck Cat. No. 49553-93-7) following an optimized version of the standard protocol(Rajendra ...
-
bioRxiv - Biophysics 2023Quote: ... and human embryonic kidney 293 (HEK293) cells were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA) and maintained in DMEM (D5796, Sigma-Aldrich, St. Louis, MO), which was supplemented with 10% FBS (12676029 ...
-
Shear stress and very low levels of ligand synergize to activate ALK1 signaling in endothelial cellsbioRxiv - Cell Biology 2023Quote: ... tccagagaagcctaaagtgat) or non-targeted control (shCont, Cat: SHC002) were generated in HEK293 cells using the Sigma Mission system (Sigma-Aldrich, St. Louis, MO USA). HUVECs were seeded into a 6-well dish at a density of 80,000 cells per well ...
-
bioRxiv - Biophysics 2021Quote: ... Micropatterned coverslips were functionalized with a solution of 10 µg mL-1 FN from human plasma (Sigma Aldrich #F1056) for 1 h at room temperature ...
-
bioRxiv - Cancer Biology 2021Quote: ... solutions of 89Zr-labeled TDM1 (4 μCi/μg) were prepared in PBS (pH 7.5) containing 1% w/v human serum albumin (HSA, Sigma) and 0.1% w/v sodium azide (NaN3 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1×105 ESCs were plated on a 3.8 cm2 plate coated with human plasma fibronectin (Millipore, cat. no. FC010) and cultured in N2B27 medium supplemented with 12 ng/ml bFGF (R&D Systems ...
-
bioRxiv - Cancer Biology 2019Quote: The AsPC-1 and Capan-2 human PC cell lines were obtained from Sigma-Aldrich (St. Louis, MO, USA) and Thermo Fisher (Waltham ...
-
bioRxiv - Neuroscience 2019Quote: ... the eye cup was treated for ∼ 15 minutes with human plasmin (∼ 50 µg mL−1, Sigma or Haematologic Technologies) to aid vitreous removal.
-
bioRxiv - Bioengineering 2020Quote: ... Three sections at varying depths within the tumor are immunostained with mouse anti-human nuclei (clone 235-1, Millipore) followed by secondary Dylight 488 horse anti-mouse (Vector) ...
-
bioRxiv - Microbiology 2021Quote: ... Antibodies to the N protein was detected by incubation for 1h at 37°C with anti-human IgG peroxidase (1:30,000, Sigma). The plates were washed three times with PBS with 0,05% Tween-20 between each step ...
-
bioRxiv - Microbiology 2021Quote: ... THP-1 (ATCC® TIB-202™) human monocyte cell line was cultured in RPMI-1640 medium (Sigma, R8758) supplemented with 10% FBS ...
-
bioRxiv - Biophysics 2021Quote: The human esaHis-tagged PTPN11 (residues 1-528) cDNA was cloned in a pET-26b vector (Novagen, MA, USA). Nucleotide substitutions associated with NS or leukemia were introduced by site-directed mutagenesis (QuikChange site-directed mutagenesis kit ...
-
bioRxiv - Neuroscience 2020Quote: ... Plates were washed with PBST and incubated with a goat anti-human Fc−peroxidase antibody diluted 1:5,000 (Sigma) in blocking buffer for 30 min ...
-
bioRxiv - Neuroscience 2020Quote: ... The plates were then washed and incubated with a 1:5,000 dilution of peroxidase-conjugated anti-human Fc antibody (Sigma) for 1 hr ...
-
bioRxiv - Neuroscience 2022Quote: ... 50% Neurobasal Medium, 0.5% N2 supplement, 1% B27 without vitamin A [Life Technologies, 12587-010], 0.025% [v/v] human insulin [Sigma, I9278] ...
-
bioRxiv - Cancer Biology 2022Quote: ... human tumor slides were stained by immunohistochemistry with an antibody against Tenascin-C (1:300, EMD Millipore, Cat. ab19011), a strain-sensitive ECM protein known to be present in LUAD [9 ...