Labshake search
Citations for Millipore Sigma :
351 - 400 of 10000+ citations for Osteopontin Human OPN ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
A scalable, GMP-compatible, autologous organotypic cell therapy for Dystrophic Epidermolysis BullosabioRxiv - Bioengineering 2023Quote: ... human specific N terminal anti-collagen VII LH7.2 (1:250 Millipore), The fluorescence images were taken using the TCS SP5 confocal laser scanning microscope (Leica) ...
-
bioRxiv - Neuroscience 2023Quote: ... and fibronectin from human plasma (Sigma-Aldrich F1056; 1 μg/ml). For some experiments ...
-
bioRxiv - Cell Biology 2023Quote: ... containing 1% Human Platelet Poor Plasma-derived Serum (SH, Sigma, P2918), 20 ng/mL FGF2 and 10 uM All-trans Retinoic Acid (RA ...
-
bioRxiv - Cell Biology 2023Quote: ... 1% PS) with freshly added 8 ng/mL human bFGF (Sigma). The medium was changed daily ...
-
bioRxiv - Neuroscience 2023Quote: ... purified calpain-1 from human or porcine erythrocytes (8 µg, Millipore) or human or rat recombinant calpain-2 produced by bacterial expression as described by (Elce et al. ...
-
bioRxiv - Bioengineering 2024Quote: ... anti-human nuclei (HuNu; 1:100; MAB4383, Merck Millipore, MA, USA), anti-Ku80 (1:100 ...
-
bioRxiv - Neuroscience 2020Quote: ... and 12-well plates containing 18-mm glass coverslips (1 ml/plate) – all plates were coated overnight with poly-D-lysine (Sigma-Aldrich, A-003-E). The cells were cultured in GibcoTM NeurobasalTM Medium (Fisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: Human IgM purified from human serum (Sigma) was digested with trypsin ...
-
bioRxiv - Microbiology 2019Quote: ... Gal-3 levels were measured using commercially available enzyme-linked immunosorbent assay (ELISA) kits (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer’s instructions.
-
Cholesterol deprivation induces TGFβ signaling to promote basal differentiation in pancreatic cancerbioRxiv - Cancer Biology 2019Quote: The amount of Shh secreted by mouse pancreatic tumor cells was quantified by using the Mouse Shh-N ELISA Kit (#RAB0431, Millipore), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: Serum and/or plasma levels of the indicated hormones and cytokines were measured by multiplex ELISA kits (Millipore, Burlington, MA) at the High-Throughput Biology Laboratory of NYU School of Medicine.
-
bioRxiv - Cell Biology 2022Quote: ... After 24-hours BrdU was added to the media and 16h later cell proliferation was evaluated using the BrdU Cell Proliferation ELISA kit (EMD-Millipore). Colorimetric analysis was done with single channel 450nm intensity ...
-
bioRxiv - Neuroscience 2023Quote: ... Acyl-ghrelin concentrations in mouse plasma samples were determined by commercial ELISA kits (EMD Millipore, Billerica, MD; Catalog #EZRGRA-90K) (91).
-
bioRxiv - Microbiology 2024Quote: ELISAs were used to confirm a subset of cytokines identified in the antibody arrays (CCL2, CX3CL1, and Galectin-3 rat ELISA kits, Sigma) using apical or basal supernatants from individual Transwell® inserts from the same experiment than the multiplex array.
-
bioRxiv - Neuroscience 2024Quote: Serum insulin and leptin were measured by an enzyme-linked immunosorbent assay (ELISA) kit (#EZRMI-13K and #EZML-82K; Millipore). Serum triglyceride levels and total cholesterol were measured using a commercial colorimetric assay kit (LaborLab® ...
-
bioRxiv - Immunology 2021Quote: ... MAb was reacted with antigen coated on the plates and then treated with serially diluted C1q from human serum (Sigma). C1q binding was detected with horseradish peroxidase-conjugated anti-C1q antibody ...
-
bioRxiv - Genomics 2020Quote: Twenty-four well plates were coated with: human or rat tail collagen type I (88 ng per well; Sigma-Aldrich), human collagen type III (88 ng per well ...
-
bioRxiv - Neuroscience 2020Quote: ... After 2 h at RT plates were washed three times and incubated with anti-human Fab specific-HRP conjugated secondary antibody (Sigma) for 1 h at RT ...
-
bioRxiv - Microbiology 2020Quote: ... Plates were washed two times and horseradish peroxidase (HRP)-conjugated goat anti-human IgG antibody (Sigma Aldrich, St. Louis, MO) was used at a 1:5,000 dilution and incubated at room temperature for 1 hour ...
-
bioRxiv - Cell Biology 2021Quote: ... GMPS were sorted as described above from CD45.1 and cells were cultured in a 12 well plate pre-coated with human fibronectin (EMD Millipore) in RPMI1640 media + 10% Fetal Bovine Serum (FBS) ...
-
bioRxiv - Cell Biology 2019Quote: Undifferentiated SGBS cells were plated at 50 % confluence in 6-well plates and infected with commercial lentiviral particles targeting either human ABCG1 (TRCN0000420907; Sigma) (TAGGAAGATGTAGGCAGATTG ...
-
bioRxiv - Neuroscience 2021Quote: ... the sections were incubated for 48 hours at 4°C with the following primary antibodies: anti-GBA (1:500; human 8E4; human and rodent G4171, Sigma-Aldrich), anti-human α-synuclein (syn211 ...
-
bioRxiv - Immunology 2023Quote: ... and plates were developed using the AEC Staining Kit (Sigma, #AEC101-1KT). After spot development ...
-
bioRxiv - Immunology 2021Quote: The S-variant and RBD coupled bead sets were incubated with sera from immunized mice at 4 dilutions (1:100; 1:1000; 1:10000; 1:100000) for 1 h in 96-well filter plates (MultiScreenHTS; Millipore) and analyzed on a Luminex analyzer (Luminex / R&D Systems ...
-
bioRxiv - Immunology 2019Quote: ... Plates were blocked with 1% casein in PBS (Sigma-Aldrich) for 2h at 37°C before primary antibodies were added (polyclonal mouse anti-Pfs230 or anti-Pfs25 antibodies ...
-
bioRxiv - Biochemistry 2019Quote: ... The plates were blocked by 1% BSA (Sigma, St. Louis), and the antibody containing sera were added after being serially diluted ...
-
bioRxiv - Microbiology 2021Quote: ... Plates were then stained with 1% crystal violet (Sigma-Aldrich) in 20% EtOH (Fisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... Plates were blocked with PBS 1% BSA (Sigma-Aldrich, A3059) and subsequently incubated with mAb serial dilutions for 1 h at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... Plates were blocked with 1% casein in PBS (Sigma-Aldrich) for recombinant antigens and with 10% skim milk in PBS for merozoites ...
-
bioRxiv - Immunology 2023Quote: ... Plates were coated with 1 μg/ml streptavidin (Sigma, S4762) diluted in PBS and incubated at 4°C overnight ...
-
bioRxiv - Immunology 2023Quote: ... plates were blocked with 1% bovine serum albumin (BSA, Sigma) for 1-2 hours at room temperature ...
-
bioRxiv - Biophysics 2024Quote: ... the plate was blocked in 1% casein (Sigma Aldrich C8654) for 1hr at 37C and washed three times with PBS ...
-
bioRxiv - Microbiology 2021Quote: ... Putative ligand proteins (elastin from human skin, fibrinogen from human plasma, laminin from human placenta, fibronectin from human plasma) (all from Sigma) were resuspended in carbonate-bicarbonate buffer (Sigma ...
-
bioRxiv - Genetics 2023Quote: ... THYE or BHI plates were supplemented with 1% (wt vol−1) xylose (Sigma-Aldrich).
-
bioRxiv - Cell Biology 2021Quote: ... 200 ng/mL recombinant human IGF-1 (LONG R3-IGF-1: 85580C, Sigma-Aldrich, MO, USA), and 20 ng/mL human bFGF] for 35 days ...
-
bioRxiv - Neuroscience 2021Quote: ... This was followed by blocking for 1 hour in 1% human serum albumin (HSA; Sigma-Aldrich) and 0.03-0.1% Triton X-100 dissolved in TBS and 200 ug/ml Digitonin (D141-100MG ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti-RBFOX1 (1:2000 for mouse and 1:1000 for human samples, Merk Millipore, MABE985), mouse anti-RBFOX2 (1:500 ...
-
bioRxiv - Immunology 2023Quote: ... This was followed by blocking for 1 hour in 1% human serum albumin (HSA; Sigma-Aldrich) and 0.03-0.1% Triton X-100 dissolved in TBS ...
-
bioRxiv - Immunology 2023Quote: ... This was followed by blocking for 1 hour in 1% human serum albumin (HSA; Sigma-Aldrich) and 0.1% Triton X-100 dissolved in TBS ...
-
bioRxiv - Cell Biology 2023Quote: ... 200 ng/mL recombinant human IGF-1 (LONG R3-IGF-1: 85580C, Sigma-Aldrich, MO, USA), and 20 ng/mL human bFGF] for 35±3 days25 ...
-
bioRxiv - Immunology 2020Quote: Genomic DNA from whole human blood was isolated using a commercially available kit (Sigma) according to manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... and maternal plasma were determined by Luminex using non-human primate multiplex kits (Millipore). Lipids were extracted from the AF using methanol to measure prostaglandins PGE2 (Oxford Biomedical Research ...
-
bioRxiv - Microbiology 2022Quote: ... and other hormones using the Luminex MILLIPLEX Human Metabolic Hormone kit (EMD Millipore, USA). Differences in hormone concentrations or fold changes were determined first with a Kruskal Wallis test and where significant ...
-
bioRxiv - Immunology 2022Quote: ... Cultures were stimulated with 20 ng/ml PMA for 3 hours and assessed with a mouse IFN-γ ELISA kit (Sigma-Millipore). For airway epithelial cell culture ...
-
bioRxiv - Physiology 2021Quote: ... extra blood was collected at each time-point and later plasma was separated by centrifugation (15min at 2,000 RPM) and stored at −80 °C for insulin measurement using a Rat/Mouse Insulin Elisa kit (EMD Millipore - EZRMI13K). Prior to sacrifice ...
-
bioRxiv - Cell Biology 2021Quote: ... The supernatants were then used to quantify the level of adiponectin using Mouse Adiponectin ELISA kit (Merck Millipore #EZMADP-6 K) according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2023Quote: ... the supernatant and the fasting and 15 min GTT serum was performed using Rat/Mouse Insulin ELISA kit (EZRMI-13K, Sigma-Aldrich).
-
bioRxiv - Pathology 2024Quote: The content of human IgG was quantitated both in the sera and aortic (tissue) homogenates from rats treated with chP3R99 or hR3 mAbs by a commercial ELISA kit (Sigma-Aldrich). Similarly ...
-
bioRxiv - Neuroscience 2022Quote: ... for Mouse 448 and human experiments or 1 mg/ml Hoechst (Sigma) for the mouse atlas experiments ...
-
bioRxiv - Biochemistry 2021Quote: ... 5% CO2 for 1 hour in human tubular fluid (HTF, EMD Millipore) at 2.0 × 106 cells/ml and co-incubated with oocytes at 2.0 × 105 sperm/ml ...