Labshake search
Citations for Millipore Sigma :
1 - 50 of 10000+ citations for N Pyrazinlyl 1 phenol 4 sulfonamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... 150 μM 4-(4-Morpholinobutylthio)phenol (MoTP) (Sigma) was added to embryos kept at 28.5°C from 24hpf onwards ...
-
bioRxiv - Neuroscience 2020Quote: ... and Carbenoxolone disodium salt (1 μg, Sigma, n=4) were infused into the bulb ...
-
bioRxiv - Neuroscience 2020Quote: PF-4778574 [N-<(3R,4S)-3-[4-(5-cyano-2-thienyl)phenyl]tetrahydro-2H-pyran-4-yl>propane-2-sulfonamide] was obtained as a powder from Sigma (catalog #PZ0211) and solubilized (2.5 mg/ml ...
-
bioRxiv - Microbiology 2021Quote: ... in the presence of phenol pH 4 (Sigma-Aldrich) with FP120 FastPrep cell disruptor (MP biomedicals) ...
-
bioRxiv - Immunology 2023Quote: ... and/or 4 μM N,N,N’,N’-tetrakis-(2-pyridyl-methyl)-ethylenediamine (TPEN; Sigma, #P4413) was added to the cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 μL phenol red (Sigma) in nuclease-free dH2O (Ambion) ...
-
bioRxiv - Biochemistry 2023Quote: Spin-trapping assays with 4-pyridyl-1-oxide-N-tert-butylnitrone (4-POBN) (Sigma-Aldrich) were carried out using leaf disks or freshly isolated thylakoid membranes at a concentration of 10 μg of Chl ml-1 ...
-
bioRxiv - Bioengineering 2022Quote: ... Polymerization of 1 M monomer was performed with 4 mol% N,N’-methylene-bis-acrylamide (Sigma-Aldrich) as a crosslinker with 0.1% (v/v ...
-
bioRxiv - Bioengineering 2022Quote: ... 4 μl of N,N,N’,N’-Tetramethylethylendiamine (TEMED, #612-103-00-3, Sigma-Aldrich now Merck) was added to 1 ml of the monomer solution ...
-
bioRxiv - Microbiology 2022Quote: ... and 4-Nitroquinoline N-oxide (Sigma) followed by incubation at 30°C for 72 hours prior to imaging ...
-
bioRxiv - Plant Biology 2024Quote: ... plants were harvested at 4 dpi and stained with a 3:1 ethanol:lacto-phenol trypan blue solution [1:1:1:1 phenol: lactic acid:water: glycerol and 0.05% trypan blue (Sigma-Aldrich)] ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 1 µl of N,N,N ′,N′ - tetramethylethylenediamine (Sigma). The solution was vortexed ...
-
bioRxiv - Bioengineering 2021Quote: ... N,N-Diisopropylethylamine (DIPEA; 2.23 mL, 12.8 mmol, 4 eq.; Sigma Aldrich) was added to the PEG solution followed by the addition of 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate] (HATU ...
-
bioRxiv - Genomics 2024Quote: ... The final gel composition included 4% N,N-Dimethylacrylamide (Sigma-Aldrich #274135), 6% acrylamide (Sigma-Aldrich #A4058) ...
-
bioRxiv - Genomics 2024Quote: ... The final gel composition included 4% N,N-Dimethylacrylamide (Sigma-Aldrich #274135), 6% acrylamide (Sigma-Aldrich #A4058) ...
-
bioRxiv - Bioengineering 2024Quote: ... N,N-Diisopropylethylamine (DIPEA; 1.1 mL, 6.4 mmol, 4 eq.; Sigma Aldrich) was added to the PEG solution followed by the addition of 1- [bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate] (HATU ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were mixed 1:1 with SB 4% (w/v) N-lauroyl-sarcosine (sarkosyl, Sigma), 2 U.μl-1 Benzonase (Novagen ...
-
bioRxiv - Molecular Biology 2020Quote: ... N-acetylcystein (NAC; Sigma A9165, 4 mM) and potassium bromate (KBrO3 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Bixafen, (N-(3’,4’-dichloro-5-fluorobiphenyl-2-yl)-3-(difluoromethyl)-1-methylpyrazole-4-carboxamide) (Bixafen, (Sigma-Aldrich, St ...
-
bioRxiv - Cancer Biology 2020Quote: ... Phenol acid chloroform 5:1 (Sigma-Aldrich) and NaCl 10 mM were then added ...
-
bioRxiv - Molecular Biology 2024Quote: ... Phenol acid chloroform (5:1; Sigma-Aldrich) and 10 mM NaCl were subsequently added to the samples ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1 uL phenol red (Sigma-Aldrich P0290), 1 uL Tol2 RNA (250 ng/uL) ...
-
bioRxiv - Genetics 2023Quote: ... The synthesized sgRNAs were extracted with phenol (pH 4–5):chloroform:isoamyl alcohol (125:24:1) (Sigma, Cat#P77619), precipitated with isopropanol ...
-
bioRxiv - Neuroscience 2020Quote: ... D2-ChR2 rats (n = 4) were anaesthetized with urethane (1.44 g kg−1, Sigma). The total dose was administered in three separate intraperitoneal injections ...
-
bioRxiv - Cell Biology 2024Quote: ... rabbit anti-Lamin A (1:500, O/N at 4°C; L1293; Sigma Aldrich), mouse anti-Ran (1:500 ...
-
bioRxiv - Cell Biology 2023Quote: N-[4-(7-diethylamino-4-methyl-3-coumarinyl)phenyl]maleimide (CPM, Sigma) was dissolved in DMSO at 4 mg/ml as stock solution and diluted 20 times using a buffer containing 25 mM HEPES ...
-
bioRxiv - Neuroscience 2022Quote: Trans-N,N′-(Cyclohexane-1,4-diyl)bis(2-(4-chlorophenoxy) acetamide (ISRIB, Sigma, SML0843) was dissolved in dimethyl sulfoxide (DMSO ...
-
bioRxiv - Neuroscience 2024Quote: ... N-(2-chloroethyl)-N-ethyl-2-bromobenzylamine hydrochloride (DSP-4) (C8417, Sigma-Aldrich, USA) is a selective neurotoxin targeting the noradrenergic system in the locus coeruleus of the brain ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 4 mM N-ethylmaleimide (Sigma Cat. E3876) and 4 mM 1,10-phenanthroline (Sigma Cat ...
-
Intra-mitochondrial proteostasis is directly coupled to alpha-synuclein and Amyloid β 1-42 pathologybioRxiv - Neuroscience 2020Quote: ... N-Methyl-4-phenylpyridinium Iodide (MPP+, Sigma-Aldrich) 10 mM in water ...
-
bioRxiv - Systems Biology 2024Quote: ... 4-hydroxy-2,2,6,6-tetramethylpiperidine-N-oxyl (Tempol, Millipore), and mitoquionone (MQ ...
-
bioRxiv - Cell Biology 2022Quote: ... and 1 µl of phenol red solution (Sigma) were mixed together and incubated for 5 minutes at 37 °C prior to injection ...
-
bioRxiv - Immunology 2023Quote: ... 1 µg/ml of phenol red (Sigma-Aldrich) was added to the medium ...
-
bioRxiv - Cell Biology 2023Quote: ... Phenol-Chloroform-isoamyl alcohol (25:24:1; Sigma) was supplemented and the samples were mixed with pipetting ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 0.1% 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-(7-nitro-2-1,3-benzoxadiazol-4-yl)_(NBD-PE) in a 4:1 mixture of silicone oil (Sigma-Aldrich) and mineral oil (Sigma-Aldrich ...
-
bioRxiv - Genetics 2022Quote: ... Chitinase activity was measured by monitoring the hydrolysis of 4-Methylumbelliferyl β-D-N,N′,N′′-triacetylchitotrioside (Sigma-Aldrich, M5639), a fluorogenic chitin substrate suitable for measuring endochitinase activity ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 mM ethylene glycol-bis(2-aminoethylether)-N,N,N′,N′-tetraacetic acid (EGTA [Sigma, E3889]), 270 mM sucrose [Sigma ...
-
bioRxiv - Immunology 2024Quote: ... β-hexosaminidase substrate (4-nitrophenyl N-acetyl-β-D-glucosaminide, 4 mM, Sigma) was then added to the supernatant and lysate for 1 h at 37°C ...
-
bioRxiv - Systems Biology 2023Quote: ... fenofibrate (n=4, 50mg/kg, Sigma-Aldrich, Cat. F6020), rosiglitazone (n=4,10mg/kg ...
-
bioRxiv - Biophysics 2023Quote: ... 4 μM N-Acetyl-L-tryptophanamide (NATA, Sigma-Aldrich) solution or buffer alone until reaching a maximum quencher concentration of 0.37 M ...
-
bioRxiv - Biochemistry 2023Quote: ... or 4 mg n-dodecyl β-D-maltoside (Sigma) per mg of protein ...
-
bioRxiv - Biochemistry 2024Quote: ... and 4-methylumbelliferone-N-acetyl-neuraminic acid (Sigma-Aldrich) at a final concentration of 250 µM in 25 mM sodium acetate buffer ...
-
bioRxiv - Plant Biology 2020Quote: Spin trapping assays with the spin probe 4-pyridyl-1-oxide-N-tert-butylnitrone (4-POBN; Sigma-Aldrich, St. Louis, USA) to detect the formation of hydroxyl radicals24 were carried out using cyanobacterial cells (OD730 = 0.65 ...
-
bioRxiv - Plant Biology 2022Quote: ... 20 μL of apoplastic fluid was combined with 30 μL of substrate solution (4-methylumbelliferyl-β-D-N,N′,N″-triacetylchitotrioside, Sigma) to a final substrate concentration of 18 μM ...
-
bioRxiv - Biophysics 2023Quote: ... 1 mM ethylene glycol-bis(2-aminoethylether)-N,N,N′,N′-tetraacetic acid (EGTA, E3889, Sigma-Aldrich), 0.1 mM ATP (BP413-25 ...
-
bioRxiv - Microbiology 2023Quote: ... prewarmed phenol solution (60°C) containing 90% phenol (Sigma), 0.1% 2-mercaptoethanol ...
-
bioRxiv - Genomics 2021Quote: ... 1% N-laurylsarcosine (Sigma), 1% SDS ...
-
bioRxiv - Neuroscience 2020Quote: ... 10 μM 4-(N-Ethyl-N-phenylamino)-1,2 dimethyl-6-(methylamino) pyrimidinium chloride (ZD7288) (Sigma-Aldich), 10 μM 1-[2-[[(Diphenylmethylene)imino]oxy]ethyl]-1,2,5,6-tetrahydro-3-pyridinecarboxylic acid hydrochloride hydrochloride (NO711 ...
-
bioRxiv - Immunology 2024Quote: ... and protease inhibitor and 1% (w/v) Zwittergent (N-Dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate, Sigma) were added ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... and 1:40 dilution of phenol red (Sigma Aldrich). The crRNA (5’CUCAUCCUCCACCACCCAGG ...