Labshake search
Citations for Millipore Sigma :
651 - 700 of 10000+ citations for Mouse SETX shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... TSC1 or AMPK knockdown in RPE1 cells were achieved by infecting cells with viruses derived from pLKO-1 harboring the shRNAs against TSC1 (TRCN0000010453 and TRCN0000039734, Sigma) or AMPK (TRCN00000196482 and TRCN00000219690 ...
-
bioRxiv - Cell Biology 2024Quote: ... GFP-PMCA4bLA and PMCA4-specific shRNA expressing MCF-7 lines were mixed with cold Matrigel (Corning Matrigel, DLW356231, Sigma-Aldrich) and 15 µl of cell-Matrigel mixtures were added to removable 8-well chambers (80841 ...
-
bioRxiv - Cell Biology 2020Quote: ... Plasmids were purified using a GenElute HP Plasmid MidiPrep Kit (Sigma-Aldrich). To generate plasmids for CRISPR/Cas9 KO cell lines ...
-
bioRxiv - Microbiology 2021Quote: ... plasmid DNA was isolated using GenElute ™ Plasmid Miniprep Kit (Sigma-Aldrich) and sequenced using the M13 primers ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... Plasmid was then extracted by GenElute™ Plasmid Miniprep Kit (Sigma-Aldrich) and verified by DNA sequencing (BMR Genomics ...
-
bioRxiv - Biophysics 2020Quote: ... Plasmids were purified using a GenElute HP Plasmid MidiPrep Kit (Sigma-Aldrich). The tgLAT construct(20 ...
-
bioRxiv - Immunology 2020Quote: ... Plasmids were purified with the GenElute Plasmid DNA Miniprep Kit (Sigma-Aldrich), quantified using the Qubit fluorometer (Thermo Fisher ...
-
bioRxiv - Microbiology 2022Quote: ... The plasmid was isolated using “GenElute™ Plasmid Midiprep” kit (Sigma Aldrich) and digested with SmaI (Thermo Scientific)
-
bioRxiv - Neuroscience 2022Quote: Plasmid DNA was purified with the GenElute HP Plasmid miniprep kit (Sigma) and microinjected in the worm gonad according to a standard protocol (Evans ...
-
bioRxiv - Molecular Biology 2022Quote: ... plasmids were purified using the GenElute HP Plasmid Midiprep Kit (Sigma-Aldrich). All of the L1 expression plasmids contain a retrotransposition-competent L1 (L1.3 ...
-
bioRxiv - Microbiology 2023Quote: ... Afterward the plasmid was isolated using GenElute plasmid miniprep kit (Sigma Aldrich). The recipient strains (AMp07 and WSM419 ...
-
bioRxiv - Plant Biology 2019Quote: Plasmid pFLAG-ATS (Sigma) was used for protein expression in this study ...
-
bioRxiv - Molecular Biology 2019Quote: pLKO.1 plasmids (Sigma) encoding shRNA for Sertad4 (TRCN0000247967 and TRCN0000247969 ...
-
bioRxiv - Microbiology 2020Quote: ... pET-32a plasmid (Novagen) was used ...
-
bioRxiv - Microbiology 2023Quote: ... the pET28a plasmid (Novagen) was used ...
-
bioRxiv - Microbiology 2023Quote: Plasmid pSTBlue-1 (Novagen) was used as the vector for routine DNA manipulations ...
-
bioRxiv - Cancer Biology 2021Quote: ... SMO-inhibitor resistant Daoy cells with shRNA-mediated knockdown of SUFU had been generated in our lab using the TRCN0000019466 construct (Sigma-Aldrich) [52].
-
bioRxiv - Cell Biology 2020Quote: ... or human NUP153-specific shRNA lentivirus particles overnight at 37°C followed by selection in medium containing Puromycin (Puro, 2 μg/ml) (Sigma-Aldrich) for 48 hr ...
-
bioRxiv - Cell Biology 2020Quote: Lentiviral particles were either generated by the laboratory (NF-κB or p53 reporter) or obtained from the MISSION shRNA library (Sigma-Aldrich). These obtained lentiviral particles harbor the following shRNA clones in pLKO.1 backbone vector and were used to infect BJ cells ...
-
bioRxiv - Developmental Biology 2020Quote: ... and RSV-Rev) and a SERPINE1 shRNA construct encoded in a PLKO.1 vector (henceforth called shPAI1: TRCN0000370159, sense: ACACCCTCAGCATGTTCATTG; Sigma-Aldrich). A control PLKO.1 vector containing a scrambled shRNA (Addgene 1864 ...
-
bioRxiv - Molecular Biology 2021Quote: J1 mES cells with doxycycline-inducible short hairpin RNA-micro RNA (shRNA – Supplementary Table 2) sequences targeting Tet1 or Tet3 were treated for 48h with 2 μg/mL doxycycline (D9891, Sigma Aldrich).
-
bioRxiv - Cancer Biology 2019Quote: ... the PDCD4 shRNA oligonucleotides (5‘-CTGGACAGGTGTATGATGTGG-3’) were synthesised and cloned into the MISSION® TRC2 pLKO.5-puro Empty Vector (SHC201, Sigma) by TsingKe Ltd ...
-
bioRxiv - Cell Biology 2021Quote: ... Cell lines stably expressing shRNA to human FBXO7 were generated as described previously (33-35) and selected with 2 µg/mL puromycin (Sigma-Aldrich). To vary glucose concentration ...
-
bioRxiv - Cancer Biology 2020Quote: Using the custom barcodes lentiviral shRNA library, PDX lines (PATC69, PATC124, PATC53 and PATC153) were transduced in vitro using 8 μg/mL Polybrene (Sigma-Aldrich). Libraries were transduced at 1000X coverage and multiplicity of infection (MOI ...
-
bioRxiv - Neuroscience 2021Quote: ... Cell lines stably expressing shRNA to human FBXO7 were generated as described previously (20) and selected with 2 μg/mL puromycin (Sigma-Aldrich).
-
bioRxiv - Cancer Biology 2020Quote: ... Lentiviral plasmids containing shRNAs targeting STING (shSTING-1 #TRCN0000161345, shSTING-2 #TRCN0000163029) or non-targeted (scrambled) shRNA (shNT #SHC016-1EA) were purchased from Sigma Aldrich. STING-IRES-GFP and DN-IRES-GFP lentiviral plasmids were generated by inserting the cDNA of STING or STING-DN ...
-
bioRxiv - Microbiology 2019Quote: Lentiviral particles carrying an anti-CTIF shRNA were produced in HEK293 cells by transfecting a commercially available pLKO.1 vector containing the shRNA sequence targeting the 3’-UTR of the CTIF mRNA (Sigma-Aldrich), pVSVg and psPax2 ...
-
bioRxiv - Cancer Biology 2021Quote: LCN2 stable knockdown clones were generated in SUM149 or MDA-IBC3 cells by using shRNA (shLCN2-1: TRCN0000060289 from Sigma-Aldrich; shLCN2-2 ...
-
bioRxiv - Immunology 2021Quote: ... pLKO.1 empty vector was from Open Biosystems, and pLKO.1 control shRNA (scramble shSCR, SHC002 and non target shNTgt, SHC016) from Sigma-Aldrich. Lentiviral vectors carrying these constructs were produced by calcium phosphate transfection of 293FT cells with shRNA constructs in combination with packaging vectors psPAX2 ...
-
bioRxiv - Cell Biology 2020Quote: ... TRCN0000073737 5’-CCGGCGCGTTATCAACTGGATCCAACTCGAGTTGGATCCAGTTGATAACGCGTTTTTG-3’ designed and cloned into the lentiviral pLKO.1 puromycin resistant vector Mission shRNA lentiviral Transduction particle (Sigma Aldrich). Control Caco2 clones (shNT ...
-
bioRxiv - Cell Biology 2021Quote: Mission plasmids directing expression of shRNAs targeting PlexinA2 (TRCN0000061499 (ShPlexA2#1) and TRCN0000061501 (ShPlexA2#2)) or PlexinA4 (TRCN0000078683) were purchased from Sigma Aldrich. The production of the lentiviruses ...
-
bioRxiv - Developmental Biology 2022Quote: 300k SV-HUC-1 cells were seeded and transfected with 3µg MISSON pLKO.1-puro non-mammalian targeting control shRNA (Sigma, Cat# SHC002) or shExoc5 (Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... Scrambled and GAN KO cell lines were generated by transducing SH-SY5Y cells with lentivirus expressing the Mission pLKO.1 backbone for scrambled shRNA (Sigma, #SHC002) and GAN shRNA (Sigma ...
-
bioRxiv - Cancer Biology 2022Quote: ... and the corresponding empty vector (Genecopoeia. MDK silencing was performed by lentiviral-driven expression of shRNAs, with pLKO-constructs purchased from Sigma Aldrich as previously reported16,17,65 ...
-
bioRxiv - Microbiology 2023Quote: ... Filtered lentiviral supernatant was introduced to MRC5 cells for FLAG-Raf1 experiments or HFF cells for shRNA experiments in the presence of 5 μg/ml Polybrene (Millipore Sigma). Three hours later ...
-
bioRxiv - Immunology 2023Quote: ... A lentiviral vector expressing shRNA against MDA5 to knock down MDA5 expression in CHME-5xISRE-Nluc (see below) was purchased from Sigma (TRCN0000232948). Lentiviral particles were generated by co-transfection of HEK293T cells with lentivectors (pDuet 5xISRE-Nluc ...
-
bioRxiv - Neuroscience 2023Quote: ... commercially available lentiviral small hairpin RNA (shRNA) vectors based on the pLKO.1 backbone (s. Key Resource Table; annotated as “transfected”) were purchased from Sigma-Aldrich. To reduce the amount of DNA needed for transfection to perform pHluorin assays ...
-
bioRxiv - Cancer Biology 2023Quote: ... HNT-34 and OCI-AML3 cells were transduced with shRNA-CD81 or non-targeting (NT) shRNA lentiviral vectors (TRCN0000300291[sh291], TRCN0000300293[sh293], TRCN0000300433[sh433] or TRC2 pLKO.5-puro; Sigma-Aldrich).
-
bioRxiv - Cancer Biology 2023Quote: ... To boost the expression of the shRNA constructs the mice were also provided with 25 mg/kg doxycycline hydrochloride (#D3447, Sigma-Aldrich) resuspended in PBS via intraperitoneal injection once a day for the first two days of doxycycline treatment.
-
bioRxiv - Cancer Biology 2024Quote: ... the cells were infected with the lentivirus expressing shRNA or cDNA in the presence of polybrene (5 μg/mL) (Sigma, USA), followed by selection with puromycin (5 μg/mL ...
-
bioRxiv - Neuroscience 2024Quote: SH-SY5Y cells with doxycycline-inducible TDP-43 shRNA expression were treated with 5 μg/mL actinomycin D (Sigma-Aldrich, A1410) for 0 ...
-
bioRxiv - Cell Biology 2023Quote: Human EndoC-βH1 and rat INS1E beta cells were cultured as previously described [45] and incubated with lentiviruses expressing an NNAT-targeting shRNA (Sigma-Aldrich) or Silencer Select siRNAs (Ambion) ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were seeded in 60 mm dishes at 50-60% confluency and transiently transfected with CEP41 shRNA (5’-GCTTACAGTTACCCAATTGCA-3’, TRCN0000143499, Sigma-Aldrich) or scramble shRNA (SHC002 ...
-
bioRxiv - Microbiology 2019Quote: ... Plasmids were isolated (GenElute Plasmid Miniprep Kit, Sigma Aldrich, St. Louis, Missouri, USA) and sequenced with suitable primers (Eurofins Genomics ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid DNA was isolated with a GenElute™ Plasmid Miniprep Kit (Sigma Aldrich) according to the provided protocol.
-
bioRxiv - Microbiology 2020Quote: ... Plasmid DNA was obtained using the GenElute Plasmid Miniprep Kit (Ref. PLN350, Sigma) also including a lysis step with lysozyme (2.5 mg/ml ...
-
Redundant and specific roles of cohesin STAG subunits in chromatin looping and transcription controlbioRxiv - Cell Biology 2019Quote: ... SiRNA constructs with the siRNA cloned in the pLKO.1-Puro vector were obtained from the MISSION shRNA library (Sigma product SHGLY). The specific siRNA sequences used are:
-
bioRxiv - Cancer Biology 2020Quote: ... SASI_Hs01_00221653) and shRNAs targeting TRIM27 (SHCLNG-NM_006510; TRCN0000280319 and TRCN0000011021) or a non-targeting control were purchased from Sigma (St. Louis, MO).
-
bioRxiv - Pathology 2021Quote: HIF-1α protein expression was depleted in human U937 cell line (ATCC, USA) using shRNA targeting HIF-1α (TCRN0000010819, Sigma Aldrich, USA) using a liposome mediated delivery (Life Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... Knockdown of EWS-FLI1 in shSK-E17T cells was performed by shRNA induction by addition of 1 μg/ml Doxycycline (Sigma-Aldrich, USA) for 7 days pre-transplantation.