Labshake search
Citations for Millipore Sigma :
501 - 550 of 10000+ citations for Mouse Putative Phospholipase B Like 2 PLBD2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... coli strain B (Sigma, D4889). To knockdown NFKB1 and p65 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.007% b-mercaptoethanol (Sigma, M3148), and 1,000 unit/ml mLIF (Millipore ...
-
bioRxiv - Microbiology 2024Quote: ... amphotericin B (AMB, Sigma-Aldrich), terbinafine (TRB ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.1 mM b-mercaptoethanol (Sigma), 1 uM PD0325901 (Stemgent 04-0006) ...
-
bioRxiv - Biochemistry 2024Quote: ... and 0.1% b-mercaptoethanol (Sigma). Cell extracts were either cleared and processed immediately or stored at -20°C ...
-
bioRxiv - Genomics 2024Quote: ... and 0.1mM B-mercaptoethanol (Sigma)) in a humidified atmosphere at 37°C with 8% CO2 ...
-
bioRxiv - Cell Biology 2024Quote: ... or latrunculin B (Sigma L5288) to cell cultures ...
-
bioRxiv - Immunology 2020Quote: ... Total IgG response was evaluated by enzyme-linked immunosorbent assays (ELISAs) using 1:5000 dilution of HRP conjugated anti mouse secondary antibody (A4416, Sigma-Aldrich, USA).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Plasma insulin and C-peptide were measured with mouse/rat ELISAs (EZRMI-13K and EZRMCP2-21K, respectively, EMD Millipore, Billerica, MA, USA). Plasma non-esterified fatty acids (NEFA ...
-
bioRxiv - Cell Biology 2021Quote: ... Insulin secreted from the islet grafts was measured in the mouse serum three weeks post-transplant using a human insulin ELISA (Millipore, EZHI-14K).
-
bioRxiv - Physiology 2021Quote: Cortisol concentrations were measured in mouse sera by a solid phase competitive enzyme linked immunosorbent assay (ELISA) (Sigma-Aldrich Co Ltd, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: IgG mediated antibody titer of serum samples collected from immunized animals and convalescent patients’ sera were determined by enzyme-linked immunosorbent assay (ELISA)35 using 1:5000 dilution of HRP conjugated anti mouse (A4416, Sigma-Aldrich, USA) and 1:10000 dilution of HRP conjugated anti human secondary antibody (A0170 ...
-
bioRxiv - Neuroscience 2021Quote: ... C-reactive protein (CRP) was measured by an ELISA kit (cat. number CYT294, Millipore Sigma, Saint Louis, MO) following the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2022Quote: ... also contained 1-2 µg/uL α-MBPAF546 or 1-2 µg/uL mouse α-BRCA2 (Ab1, Millipore) plus 1-2 µg/µL goat α-mouse IgGAF546 (Molecular Probes).
-
bioRxiv - Evolutionary Biology 2020Quote: ... were passaged in M9 salt medium (Difco) with 2% sodium chloride supplemented with a) casamino acids (Difco) or b) sodium caseinate (Sigma) (referred to as ‘M9-casein’ and ‘M9-CAA’ herein) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... SAG1.3 (3-Chloro-N-[trans-4-(methylamino)cyclohexyl]-N-[[3-(4-pyridinyl)phenyl]methyl]benzo[b]thiophene-2-carboxamide) was from Sigma. Cyclopamine-KAAD and SANT-1 ((4-Benzyl-piperazin-1-yl)-(3,5-dimethyl-1-phenyl-1H-pyrazol-4-ylmethylene)-amine ...
-
bioRxiv - Bioengineering 2022Quote: ... 7 kDa:17 kDa) and Poly(D,L-lactide-glycolide) 50:50-b-PEG (10kDa PLGA, 2 kDa PEG) were purchased from Sigma.
-
bioRxiv - Neuroscience 2022Quote: ... the medium was changed to Ngn2-medium (Table 1) and cytosine b-D-arabinofuranoside (Ara-C) (2 μM; Sigma, C1768) was added once to remove proliferating cells from the culture ...
-
bioRxiv - Developmental Biology 2024Quote: ... mouse NPCs from E13.5 WT and PlyA-KI forebrain were dissociated and cultured in serum-free N-2/B-27/DMEM medium with 10 ng/ml FGF2 (Life Tech) in poly-L-lysine (PLL, Sigma)-coated 6 well culture plates (Costar ...
-
bioRxiv - Genetics 2024Quote: ... differentiation of iPSCs was induced through the Wnt modulation method with 7 μM glycogen synthase kinase 3 b (GSK3b) inhibitor CHIR99021 (Selleckchem) and 5 μM inhibitor of WNT production 2 (IWP2) (Sigma). Basal Media was composed of RPMI media supplemented with B27 (Thermo Fisher Scientific) ...
-
bioRxiv - Pathology 2019Quote: ... a Milliplex mouse cytokine magnetic kit (Millipore, France) was used according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2022Quote: ... A Milliplex Mouse Th17 Luminex kit (EMD Millipore) with analytes IL-1β ...
-
bioRxiv - Immunology 2021Quote: ... A Milliplex Mouse Th17 Luminex kit (MD MilliPore) with analytes IL-1β ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 mg/mL of 70 kDa dextran conjugated to rhodamine b isothiocyanate (Rhod B, Sigma) was introduced from one media reservoir ...
-
bioRxiv - Immunology 2020Quote: ... For experiments using the LPS inhibitor polymyxin B (PMB, Polymyxin B sulfate salt, Sigma-Aldrich), the samples were mixed with PMB and incubated for 30 min at RT before being added to the cultivated cells ...
-
bioRxiv - Biochemistry 2020Quote: ... For ELISAs with asialofetuin (Sigma Aldrich # A4781), 5 μg/mL was immobilized ...
-
bioRxiv - Physiology 2023Quote: ... Insulin was measured by ELISA (Millipore Sigma). For glucose tolerance tests ...
-
bioRxiv - Immunology 2022Quote: ... IL-10 and TNF-α were determined in 24 h culture supernatant of UNT control and treated MOs using respective ELISA kits (Sigma-Aldrich kit, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... the following were incubated for 15-18hrs at 4°C in PBS with 0.3% Triton-X and 5% goat serum: mouse biotin conjugated anti-NeuN B-clone A60 (MAB377, Millipore, 1:500), rabbit anti-calbindin (C2724 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The membranes were incubated in a primary rabbit α-human A3A/B/G antibody 1:1,000 (Brown et al.) and mouse α-tubulin 1:10,000 (Sigma Aldrich), or rabbit α-actin 1:5,000 (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2019Quote: ... The mouse VDAC1-specific shRNA sequence 2 GTTGGCTATAAGACGGATGAACT (Sigma-Aldrich, Ref. #TRCN0000012391), the VDAC1 shRNA sequence 3 ACCAGGTATCAAACTGACGTTCT (Sigma-Aldrich ...
-
bioRxiv - Pathology 2021Quote: ... Mouse anti-E2F4 monoclonal antibody (mAb) clone LLF4-2 (MABE160; Merck Millipore) used at 1/400 for PLA ...
-
bioRxiv - Pathology 2021Quote: ... 1 μg/mL natural mouse laminin and 2 μM Arabinosylcytosine (Sigma-Aldrich). 48 hours later NSM medium was fully exchanged ...
-
bioRxiv - Biophysics 2022Quote: ... and mouse myotubes were treated with thapsigargin (2 μg mL-1; Sigma) for 10 h ...
-
bioRxiv - Neuroscience 2022Quote: ... and anti-glutamate receptor 2 (mouse anti-GluR2 IgG2a; Millipore; 1:2000). Sections were then washed with PBS and incubated in Alexa Fluor-conjugated fluorescent secondary antibodies (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse monoclonal against alpha-tubulin (1:1000; b5-1-2, Sigma, T6074). Actin was stained using 100 nM of phalloidin-iFluor488 for 30 min ...
-
bioRxiv - Bioengineering 2020Quote: ... THP-1 cells were differentiated into macrophage-like cells with 150 nM phorbol 12-myristate 13-acetate (PMA) (Sigma) before the experiment.
-
bioRxiv - Cancer Biology 2022Quote: ... 0.001% SDS to the volume of 90 µl per measurement and supplemented with 10 µl of 0.5mM proteasome substrates in the assay buffer: Substrate III (Suc-LLVY-AMC, chymotrypsin-like activity, Millipore), Substrate IV (Z-ARR-AMC ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human plasma like media (HPLM) was generated according to the published formulation59 with addition of 5% dialyzed FBS (Sigma) and Pen/Strep (Invitrogen) ...
-
bioRxiv - Immunology 2023Quote: ... Antibody binding to N protein was detected using conventional two-step ELISA with an HRPO-conjugated anti-mouse or anti-rat Fc antibody (Sigma Aldrich cat # A9309). All assays included a standard curve of mouse neutralising S1 antibody and mouse anti-N antibody (Sino Biological) ...
-
bioRxiv - Cell Biology 2020Quote: ... Carbonyl cyanide α-[3-(2-benzothiazolyl)6-[2-[2-[bis(carboxymethyl)amino]-5-methylphenoxy]-2-oxo-2H-1-benzopyran-7yl]-b-(carboxymethyl)-tetrapotassium salt (FCCP, cat. n. C2920, Sigma-Aldrich) was solubilized in ethanol to a final stock concentration of 10 mM ...
-
bioRxiv - Neuroscience 2021Quote: ... after 3 DIV the medium of some cultures was replaced for 2 h by fresh medium devoid of B-27 and GlutaMAX-I supplement and then cells were incubated for 2 h with 10-10 M E2 (Sigma-Aldrich) or vehicle ...
-
bioRxiv - Cell Biology 2022Quote: ... Log phase promastigote cultures (seeded at 2×106 cell/ml) were allowed to grow in complete M199 supplemented with 150 μM biotin (B-4639, Sigma-Aldrich) for 18-24 hours ...
-
bioRxiv - Biophysics 2021Quote: ... Au-micellar solution was obtained first by dissolving a diblock copolymer polystyrene-b-poly(2-vinylpyridine) (Polymer Source) in o–xylene and second by loading with HAuCl4 · 3H2O (Sigma Aldrich) according to the specific parameter L = n[HAuCl4]/n[P2VP] ...
-
bioRxiv - Cell Biology 2021Quote: ... The tissue was homogenized 20 times with pestle A and 20 times with pestle B in 2 ml of ice-cold nuclei EZ lysis buffer (NUC101-1KT, Sigma-Aldrich). Then ...
-
bioRxiv - Microbiology 2022Quote: ... 100-200 μl culture aliquots were transferred to 2 ml Eppendorf tubes with perforated lids followed by addition of 7 μM (10 μg/ml) polymyxin B (Sigma-Aldrich) or 31 μM (30 μg/ml ...
-
bioRxiv - Plant Biology 2023Quote: ... 5 μL lysate was mixed with 45 μL MUG (methylumbelliferyl b-D-glucuronide) solution (10 mM Tris/HCl pH 8, 2 mM MgCl2, 1 mM MUG (Sigma Aldrich)) in a 96-well plate ...
-
bioRxiv - Neuroscience 2024Quote: ... half of the medium was substituted with a culture medium supplemented with 2% B-27 plus supplement and 5μM of cytosine β-d-arabinofuranoside (Ara-C; Sigma; #C1768). The culture medium was then changed every three days ...
-
bioRxiv - Cancer Biology 2021Quote: ... and GM-CSF levels were quantified using ELISA kits pre-coated with indicated capture antibodies per manufacturer’s instructions (Sigma). IL-6 levels were preliminarily detected using a Q-Plex Human cytokine screen (16-plex ...
-
bioRxiv - Immunology 2021Quote: ... Latrunculin B (Lat B, 428020, MilliporeSigma) and Jasplakinolide (Jas, 420107, MilliporeSigma)/Blebbistatin (Bleb, B0560, Sigma-Aldrich) were used for manipulating CD20 mobility ...