Labshake search
Citations for Millipore Sigma :
301 - 350 of 10000+ citations for Mouse Protein Jagged 2 JAG2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: Total GLP1 protein in brain tissue or in plasma was determined using GLP-1 Total ELISA 96-Well Plate Assay (Sigma-Aldrich, EZGLP1T-36K). The assay was conducted according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2019Quote: ... The mouse VDAC1-specific shRNA sequence 2 GTTGGCTATAAGACGGATGAACT (Sigma-Aldrich, Ref. #TRCN0000012391), the VDAC1 shRNA sequence 3 ACCAGGTATCAAACTGACGTTCT (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2019Quote: ... mouse anti-alpha-tubulin ([B-5-1-2], Sigma, T5168, RRID AB_477582) and ATTO647N-conjugated anti-GFP nanobodies (GFPBooster-ATTO647N ...
-
bioRxiv - Pathology 2021Quote: ... Mouse anti-E2F4 monoclonal antibody (mAb) clone LLF4-2 (MABE160; Merck Millipore) used at 1/400 for PLA ...
-
bioRxiv - Pathology 2021Quote: ... 1 μg/mL natural mouse laminin and 2 μM Arabinosylcytosine (Sigma-Aldrich). 48 hours later NSM medium was fully exchanged ...
-
bioRxiv - Cancer Biology 2019Quote: ... α-tubulin mouse (1:10000 WB, clone B-5-1-2, Sigma-Aldrich), p120 catenin mouse (1:1000 WB ...
-
bioRxiv - Biophysics 2022Quote: ... and mouse myotubes were treated with thapsigargin (2 μg mL-1; Sigma) for 10 h ...
-
bioRxiv - Cancer Biology 2022Quote: ... mouse tubulin (clone B-5-1-2, Sigma, T5168-.2ML; 1/5000), and p21 Waf1/Cip1 (clone 12D1 ...
-
bioRxiv - Neuroscience 2022Quote: ... and anti-glutamate receptor 2 (mouse anti-GluR2 IgG2a; Millipore; 1:2000). Sections were then washed with PBS and incubated in Alexa Fluor-conjugated fluorescent secondary antibodies (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse monoclonal against alpha-tubulin (1:1000; b5-1-2, Sigma, T6074). Actin was stained using 100 nM of phalloidin-iFluor488 for 30 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... mouse anti-Tubulin (1:3,000; Sigma clone B-5-1-2, T5168), and mouse anti-b-Actin (1:1,000 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse monoclonal anti-heat shock protein 70 (HSP70) (H5147, Sigma-Aldrich, 1:500), rabbit monoclonal anti-Alix (MCA2493 ...
-
bioRxiv - Biochemistry 2022Quote: ... S5H recombinant protein was examined by using specific anti-His mouse antibody (Novagen) as described in (López-Gresa et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... and glial fibrillary acidic protein (GFAP) conjugated Cy3 produced in mouse (Sigma, C9205). Slides were cover-slipped with ProLong Gold with DAPI (Invitrogen) ...
-
bioRxiv - Neuroscience 2019Quote: ... mouse anti-glial fibrially acidic protein (GFAP, 1:100, MA360, Millipore, MA, USA) and rabbit anti-phosphorylated TrkBS478 (1:200 R-1718-50 ...
-
bioRxiv - Plant Biology 2020Quote: ... antiserum against FLAG fusion proteins was obtained from Sigma-Aldrich (F1804, mouse monoclonal). An anti-rabbit horseradish peroxidase-conjugated antiserum (#7074 ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti-microtubule associated protein (MAP2; 1:1,000; Sigma‐Aldrich; St Louis, USA); DAPI (1:2,000 ...
-
bioRxiv - Biochemistry 2020Quote: ... ATP11A protein was labeled with mouse anti-Flag antibody (1:2000, Sigma, Germany) and the endoplasmic reticulum (ER ...
-
bioRxiv - Cell Biology 2022Quote: ... and anti-mouse GAPDH 0.2 μg/mL (Millipore Sigma, G8795; protein loading control). IRDye®-800CW goat anti-rabbit and −680RD goat anti-mouse IgG secondary antibodies at a 0.1 μg/mL concentration (LI-COR Biosciences ...
-
bioRxiv - Neuroscience 2022Quote: ... and mouse anti-glial fibrillary acidic protein (GFAP; 1:500, #G3893; Sigma-Aldrich). The next day sections were washed 3 times with the blocking buffer (15 min each ...
-
bioRxiv - Cell Biology 2023Quote: ... Mouse anti-Golgi 58K protein (formimidoyltransferase-cyclodeaminase) mAb (G2404) was from Sigma-Aldrich and used at a dilution of 1:50∼100 ...
-
bioRxiv - Biophysics 2020Quote: ... For reduction and alkylation of the proteins, proteins were incubated with SDC buffer (1% Sodiumdeoxycholate, 40nmM 2-Cloroacetamide (Sigma-Aldrich), 10 mM tris(2-carboxyethyl ...
-
bioRxiv - Molecular Biology 2019Quote: EZ-Magna RNA-binding protein immunoprecipitation kit (Millipore, USA) was performed according to the manufacture’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: Millipore Compartment Protein Extraction Kit (Merck-Millipore, Cat. #2145) was used to deplete cytosolic ...
-
bioRxiv - Cell Biology 2023Quote: ... immunoreactive proteins were detected using Immobilon Western Kit (Millipore). Protein bands from each blot were observed by an imaging system (ChemiDoc XRS+ ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were visualized using enhanced chemiluminescent detection kit (Millipore). To detect changes in the protein glycosylation ...
-
bioRxiv - Molecular Biology 2023Quote: ... Elutions were precipitated using ProteoExtract Protein precipitation kit (Millipore) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... Protein was estimated using BCA kit (Sigma Aldrich, USA) and 20 µg protein was loaded on 12% SDS-PAGE gel ...
-
bioRxiv - Neuroscience 2024Quote: ... Protein quantification was performed using the BCA kit (Sigma), except for insoluble fractions due to due to formic acid’s denaturation effect ...
-
bioRxiv - Cancer Biology 2021Quote: ... and GM-CSF levels were quantified using ELISA kits pre-coated with indicated capture antibodies per manufacturer’s instructions (Sigma). IL-6 levels were preliminarily detected using a Q-Plex Human cytokine screen (16-plex ...
-
bioRxiv - Biochemistry 2020Quote: ... The precipitated proteins were used for determination of protein content using a Bicinchoninic Acid Protein Assay Kit (Sigma-Aldrich, Taufkirchen, Germany).
-
bioRxiv - Microbiology 2021Quote: ... were immunized in a prime-boost-boost regimen with post-fusion hMPV B2 F protein (50 µg protein/mouse) in a water in oil emulsion with Titermax Gold adjuvant (Sigma-Aldrich) via subcutaneous (SC ...
-
bioRxiv - Cell Biology 2023Quote: Proteins were extracted from 50 hpf zebrafish embryos using the lysis buffer from the calpain 1/2 activity kit (InnoZyme™ Calpain 1/2 Activity Assay Kit CBA054 purchased from Merck Millipore). Protein concentration was adjusted to 2 mg/mL and calpain enzymatic activity was measured in microtubes following the manufacturer instructions ...
-
Optimization and deoptimization of codons in SARS-CoV-2 and the implications for vaccine developmentbioRxiv - Evolutionary Biology 2022Quote: ... About 2×106 cells of HEK293T cells were transfected with 2 ug of plasmids encoding S proteins using polyetherimide (PEI; Sigma). After 16 hours of incubation ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein-protein interactions were assessed using the PLA Duolink in situ starter kit (Sigma Aldrich, DUO92101) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total protein concentration was determined using the Bicinchoninic Acid Protein Assay Kit (Sigma-Aldrich Cat# BCA1) as per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein-protein interactions were detected using the Detection Kit Red (DUO92008) according to the manufacturer’s (Sigma) instructions ...
-
bioRxiv - Physiology 2023Quote: ... The total protein content in samples was obtained using a BCA protein assay kit (Sigma-Aldrich) with the SpectraMax Paradigm microplate reader (Molecular Devices ...
-
bioRxiv - Biochemistry 2022Quote: ... AviTagged trimeric S and RBD proteins were biotinylated using the Enzymatic Protein Biotinylation Kit (Sigma-Aldrich).
-
bioRxiv - Cell Biology 2019Quote: ... 2 μl lambda protein phosphatase (800 U) and buffer components as instructed (Sigma) and the reaction was terminated after 30 min at 30 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... Proteins were reduced with 10 mM Tris(2-carboxyethyl)phosphine (TCEP; Sigma-Aldrich) for 1 h at room temperature followed by alkylation of cysteine residue side chain thiol groups with iodoacetamide (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2020Quote: ... The CbAgo protein was expressed in E.coli Bl21(DE3) Rosetta™ 2 (Novagen). Cultures were grown at 37 °C in LB medium containing 50 μg ml−1 kanamycin and 34 μg ml−1 chloramphenicol till an OD600 nm of 0.7 was reached ...
-
bioRxiv - Biophysics 2019Quote: ... The CbAgo protein was expressed in E.coli Bl21(DE3) Rosetta™ 2 (Novagen). Cultures were grown at 37°C in LB medium containing 50μa.g ml-1 kanamycin and 34μg ml-1 chloramphenicol till an ODóOOnm of 0.7 was reached ...
-
bioRxiv - Biochemistry 2019Quote: ... and 1% NP-40 containing protein phosphatase inhibitor cocktail 1 and 2 (Sigma) and protease inhibitors (Sigma)] ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... antimicrotubule-associated protein 2 (MAP2) Alexa Fluor 647 (1:500, NB120-11267AF647; Millipore). Cell nuclei were stained by using Hoescht 33342 (2 μg/mL ...
-
bioRxiv - Biochemistry 2022Quote: ... Samples were subsequently incubated for 2 h with Protein-G–Sepharose (Sigma-Aldrich). After 3 washes with lysis buffer ...
-
bioRxiv - Biophysics 2023Quote: ... recombinant Rad26 protein was expressed in Escherichia coli strain Rosetta 2(DE3) (Novagen) and purified by Ni-NTA agarose (Qiagen) ...
-
bioRxiv - Neuroscience 2020Quote: ... Protein from gels were transferred onto PVDF membranes and probed with NSF (SYSY, mouse monoclonal) and beta actin (Sigma, mouse monoclonal) antibodies overnight with shaking ...
-
bioRxiv - Immunology 2020Quote: ... the membranes were incubated with the appropriate horseradish-peroxidase conjugated secondary Ab (1:5000 in TBST + 2% BSA; 2 h at room temperature; anti-mouse A4416 and anti-rabbit A0545, Sigma). The immunoreactivity was detected by ECL reagents (Amersham) ...
-
bioRxiv - Bioengineering 2022Quote: ... Peanut-specific IgG1 was detected using goat anti-mouse IgG1-HRP conjugated (Southern Biotechnology Associates) and substrate TMB liquid substrate system for ELISA (Sigma-Aldrich, St. Louis, MO). The plates were read in an ELISA plate reader at 405 nM (IgE ...