Labshake search
Citations for Millipore Sigma :
101 - 150 of 10000+ citations for Mouse ONECUT3 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... The pLenti pLKO-non-target shRNA control vector (SHC002) and two different pLenti-mouse shRNA vectors for FYN were selected from Sigma Aldrich MISSION® shRNA Vectors ...
-
bioRxiv - Neuroscience 2022Quote: ... We purchased a MISSION shRNA vector library encoding the microRNA-adapted shRNA targeting mouse Inka1 (Sigma-Aldrich, St. Louis, MO, USA). Among five shRNA clones (TRCN0000269004 ...
-
bioRxiv - Cell Biology 2020Quote: ... and Synt16 shRNA (Sigma-Aldrich, Mission shRNA, TRCN0000161930). Lentivirus were recovered in supernatant after 2 days and concentrated ...
-
bioRxiv - Neuroscience 2023Quote: ... The shRNA universal negative control (Sigma, Control shRNA) was used as a non-targeting control (Suppl ...
-
bioRxiv - Neuroscience 2024Quote: ... The shRNA universal negative control (Sigma, Control shRNA) was used as a non-targeting control (Suppl ...
-
bioRxiv - Neuroscience 2019Quote: ... The mouse VDAC1-specific shRNA sequence 2 GTTGGCTATAAGACGGATGAACT (Sigma-Aldrich, Ref. #TRCN0000012391), the VDAC1 shRNA sequence 3 ACCAGGTATCAAACTGACGTTCT (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2019Quote: RIPK3 shRNA targeting mouse RIPK3 RNA were purchase from Sigma (TRCN0000022536, TRCN0000424625). MLKL shRNA targeting mouse MLKL RNA were purchase from Sigma (TRCN0000022599 ...
-
bioRxiv - Cancer Biology 2019Quote: ... MLKL shRNA targeting mouse MLKL RNA were purchase from Sigma (TRCN0000022599, TRCN000022602). Lentivirus expressing RIPK3 shRNA was generated by transfecting HEK-293T cells in 6 well plate with a 1 ...
-
bioRxiv - Neuroscience 2022Quote: Lentivirus expressing shRNA against mouse ATPSCKMT was produced according protocol (Sigma-Aldrich). In short ...
-
bioRxiv - Cell Biology 2022Quote: ... shRNA clones were purchased from lentiviral vector-based shRNA libraries (MISSION shRNA library, Sigma-Aldrich). Lentivirus packaging was performed as previous reported (89) ...
-
bioRxiv - Cell Biology 2021Quote: ... For Syntenin-1 target pLKO.1 plasmids with shRNA sequences were obtained from Sigma mission library (KD1 ...
-
bioRxiv - Cell Biology 2022Quote: ... a plasmid (pLKO.1-puro backbone) containing shRNA sequence (CCGGGATGAAGAATATCGTCCACAACTCGAGTTGTGGACGATATTCTTCATCTTTTTG) was purchased from Sigma (Mission shRNA ...
-
bioRxiv - Cancer Biology 2020Quote: ... The non-silencing shCTR (mission control shRNA plasmid DNA) was purchased from Sigma aldrich. Transfection medium was replaced 24 h later with new complete DMEM and 48 h after transfection the lentiviral containing medium was collected ...
-
bioRxiv - Cell Biology 2023Quote: ... RBL2 and non-targeting control shRNA lentiviral transfer plasmids were either purchased from Sigma or generated by cloning sequences into pSicoR-Ef1a-mCh-Puro-Puro (#31847;Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... the DNA mix (1.34 μg shRNA-plasmid DNA (TRCN0000296954; TRCN0000291711, Sigma-Aldrich, Taufkirchen, Germany) or pLV[Exp]-EGFP:T2A:Bsd-CMV>ORF_Stuffer (VectorBuilder ...
-
bioRxiv - Genomics 2022Quote: Non-targeting shRNA construct was obtained from Sigma (SHC202; pLKO.5-puro Control Plasmid). Zfp281 targeting shRNA gene was obtained from Sigma (Clone ID ...
-
bioRxiv - Molecular Biology 2021Quote: Pre-designed shRNA sequences (MISSION® shRNA library (Sigma); Table 2 ...
-
bioRxiv - Neuroscience 2021Quote: ... 10µg of shRNA vector (Mission® shRNA, Sigma Aldrich), 2.9µg pRSV-REV ...
-
bioRxiv - Cancer Biology 2021Quote: ... were subjected to lentiviral transduction with either the Tg2-targeting MISSION shRNA plasmid (SHCLND-NM_004613: TRCN0000272816) (MDA- (scr)) or the MISSION scr.1-puro scrambled control plasmid DNA (SHC001; Millipore Sigma) (MDA- (shTg2)) ...
-
bioRxiv - Cancer Biology 2022Quote: ... As a negative control a plasmid expressing the scramble sequence (MISSION pLKO.1-puro shRNA Control Plasmid DNA) was purchased from Sigma- Aldrich.
-
bioRxiv - Cancer Biology 2021Quote: MISSION shRNA targeting mouse or human PSME4 or RFP were obtained from Sigma (TRCN0000176569 ...
-
bioRxiv - Cell Biology 2022Quote: ... the same pLKO-based plasmid expressing a non-target shRNA was purchased from Sigma-Aldrich and used ...
-
bioRxiv - Cell Biology 2019Quote: shRNA expression plasmids (in pLKO.1 or pLKO1.5) were obtained from Sigma (Supplemental Table 4). pLKO.3G (Addgene ...
-
bioRxiv - Cell Biology 2019Quote: ... the pLKO.1-puro non-mammalian shRNA Control Plasmid DNA was used (SHC002, Sigma-Aldrich). Two million Ecadherin-GFP MDCK cells were electroporated (Neon Transfection System Invitrogen ...
-
bioRxiv - Immunology 2022Quote: ... HeLa cells were transfected using Lipofectamine2000 and 200 ng of MISSION shRNA plasmids (Sigma-Aldrich, TRCN0000006342 ...
-
bioRxiv - Microbiology 2022Quote: ... lentiviral plasmids containing COL6A1 or COL6A3 short hairpin RNA (shRNA) (Sigma-Aldrich, TRCN0000116959 and TRCN0000003622), or MISSION pLKO.1-puro Non-Mammalian shRNA Control (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2022Quote: ... Elavl1 shRNAs were adapted from the MISSION shRNA library (Sigma). Annealed oligos were digested with FastDigest XhoI/EcoRI (ThermoFisher ...
-
bioRxiv - Cancer Biology 2020Quote: ... shRNAs were selected among pre-validated Mission pLKO1-shRNA (Sigma) and the corresponding U6-shRNA-cPPT cassettes were subcloned into PB-empty vector (24) ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA constructs targeting BRD2 were purchased from Sigma (Mission shRNA).
-
bioRxiv - Molecular Biology 2022Quote: We co-transfected HEK293T cells with overexpression plasmids or shRNA viral plasmids with lentiviral packaging vectors using X-tremeGENE 9 (Sigma-Aldrich), and we collected viruses at 48 h post-transfection ...
-
bioRxiv - Cancer Biology 2019Quote: ... Scrambled shRNA (Sigma) was used as negative control ...
-
bioRxiv - Cancer Biology 2020Quote: Mission shRNAs (Sigma) were used for RNA interference ...
-
bioRxiv - Cancer Biology 2020Quote: ... shRNA oligos (Sigma) were annealed by temperature ramp from 100°C to 25°C and cloned into pLKO.1 vector between AgeI and EcoRI sites ...
-
bioRxiv - Neuroscience 2023Quote: ... Dusp6 shRNA (Sigma, mission shRNA ...
-
bioRxiv - Microbiology 2022Quote: ... The following shRNAs were used: Non-Targeting Control shRNA (Sigma, SHC002), EIF4E2 shRNA#1 (sh4EHP#1 ...
-
bioRxiv - Pathology 2023Quote: Lentiviruses expressing inducible shRNA (Sigma-Aldrich, MISSION™ shRNA inducible vectors) were used to silence HDAC and ATG5 ...
-
bioRxiv - Neuroscience 2020Quote: ... SH-SY5Y cells were transfected with pLKO.1 vector (MISSION ® shRNA plasmid DNA, Sigma-Aldrich) containing a hairpin sequence of FXN (TRCN0000006138 ...
-
bioRxiv - Cancer Biology 2021Quote: ... we transduced LXF-289 (A3A) cells with the non-mammalian shRNA Control Plasmid DNA shC002 (Sigma).
-
bioRxiv - Biophysics 2021Quote: ... IRSp53 60950 shRNA and control Non-Targeting shRNA were purchased from Sigma Mission for viral transfection and stable cell line creation ...
-
bioRxiv - Cancer Biology 2024Quote: ... Two different short hairpin (shRNA, from Sigma-Aldrich shRNA library; Table 1), scrambled shRNA control (Addgene plasmid #1864) ...
-
bioRxiv - Neuroscience 2024Quote: ... or one of the RCOR3-shRNA-mCherry-BSD plasmids or the TetO-SOX9-NFIB-mPlum-Puro plasmid using Polyethyleneimine (Sigma-Aldrich, USA, #408727). DNA is added in a ratio of 4:2:1:1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The shRNAs constructs (Sigma) used in this study are as follows ...
-
bioRxiv - Molecular Biology 2019Quote: ... The shRNAs constructs (Sigma) used in this study are as follows ...
-
bioRxiv - Cancer Biology 2020Quote: ... shRNA construct shMYC:TRCN0000039642 (Sigma) was cloned into pLKO.1-Tet-Neo obtained from Addgene ...
-
bioRxiv - Molecular Biology 2020Quote: ... AGO1 (shRNA: TRCN0000007859, Sigma), AGO2 (shRNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... GW182 (shRNA: TRCN0000376423, Sigma), or control vector (pLK0.1) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Dicer (shRNA: TRCN0000051258, Sigma), GW182 (shRNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... AGO2 (shRNA: TRCN0000011203, Sigma), Dicer (shRNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... MISSION shRNA clones (Sigma) in pLKO.1 backbone were ...
-
bioRxiv - Genomics 2020Quote: ... shRNAs obtained from Sigma (ISL1 ...