Labshake search
Citations for Millipore Sigma :
501 - 550 of 10000+ citations for Mouse OLFR139 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Mission shRNA Lentiviral particles designed to target CD95L were purchased: shL3 (Sigma TRCN0000059000), shL1 (Sigma TRCN0000058999) ...
-
bioRxiv - Molecular Biology 2023Quote: ... lentiviruses were produced using vectors from the Mission TRC shRNA library (Sigma-Aldrich) targeting DDB1 (#1 TRCN0000082855 ...
-
bioRxiv - Cell Biology 2024Quote: U2OS cells were first knocked down for endogenous BLTP2 using shRNA (Sigma TRCN0000128410) that targets only the 3’UTR of the BLTP2 mRNA ...
-
bioRxiv - Microbiology 2023Quote: ... The shRNAs targeting human MARCHF8 were ordered from Sigma-Aldrich (St. Louis, MO). The sgRNAs targeting Marchf8 were designed using the web-based software ChopChop (chopchop.cbu.uib.no ...
-
bioRxiv - Cancer Biology 2023Quote: ... or the pLKO.1-puro-shRNA vectors to target DYRK3 or CAMKV (Sigma Mission clone number available upon request ...
-
bioRxiv - Cancer Biology 2023Quote: Short hairpin RNA sequences targeting FTO or nontarget ‘scrambled’ shRNA control (Sigma-Aldrich) were ordered as forward and reverse oligos ...
-
bioRxiv - Molecular Biology 2021Quote: ... Mrhl shRNAs (custom synthesised) and non-target control (SHC332) were procured from Sigma-Aldrich. qPCR was performed using BioRad’s CFX96 machine ...
-
bioRxiv - Cancer Biology 2020Quote: ... VCaP cells were cultured for five days following transfection PAT4 shRNA lentivirus (TRCN0000043984; Sigma). Cells were incubated in the isolation media for a period of 24 hours and EVs were purified from the conditioned media via size-exclusion chromatography (SEC).
-
bioRxiv - Cancer Biology 2021Quote: Short hairpin RNAs (shRNA) for target genes and scramble (shCtrl) were purchased from Sigma. pBabe-puro plasmids containing human C/EBPB LAP2 and LIP isoforms were from Addgene (Cat.# 15712 and 15713).
-
bioRxiv - Cancer Biology 2021Quote: ... and A549TP53-/- A3A) were made using the Mission shRNA lentiviral vector NM_020187.1-133s1c1 (Sigma). Lentiviral particles were produced in HEK293T cells using a pLKO.1-shRNA plasmid ...
-
bioRxiv - Cancer Biology 2022Quote: ... 50,000 human ECs (RBPJ knock-out or shRNA for CXCL2 (pLKO.1; Sigma Aldrich) and respective controls ...
-
bioRxiv - Physiology 2022Quote: ... pLKO-PCMT1 construct (TRCN0000036403) and Non-Target shRNA Control (SHC016) were from Sigma-Aldrich. Lentiviral pLKO constructs were transfected with packaging and envelope plasmids to HEK293T cells ...
-
bioRxiv - Immunology 2020Quote: ... were obtained from the whole RNAi human library for shRNA mediating silencing (Sigma, Aldrich) maintained at IISER ...
-
bioRxiv - Cell Biology 2022Quote: ... or PTK7-targeting shRNAs from the Sigma MISSION library (Millipore Sigma, Cat# SHCLNG-NM_002821): sh31 ...
-
bioRxiv - Immunology 2020Quote: ... were obtained from the whole RNAi human library for shRNA mediating silencing (Sigma, Aldrich) maintained at IISER ...
-
bioRxiv - Microbiology 2019Quote: ... was used to express short hairpin RNAs (shRNAs) targeted against REAF (Mission TRCN0000141116, Sigma). Additionally ...
-
bioRxiv - Microbiology 2020Quote: Three lentiviral Mission short hairpin RNA (shRNA) clones targeting UBE4B were obtained from Millipore-Sigma ...
-
bioRxiv - Immunology 2022Quote: ... three short hairpin RNAs (shRNAs) against DRAM1 (NM_027878) from the Mission library (Sigma-Aldrich) were used ...
-
bioRxiv - Molecular Biology 2023Quote: ... The shRNAs expressed by the pKLO.1-puro vector were purchased from Sigma-Aldrich. The sequences for human shDiPRO1 were as follows:
-
bioRxiv - Molecular Biology 2023Quote: ... The 4EBP1 shRNA lentivirus carrying puromycin resistance was purchased as lentiviral particles (Sigma-Aldrich). The 4EBP2 shRNA was cloned into the pLKO.1_BlastR lentiviral backbone (52) ...
-
bioRxiv - Cancer Biology 2023Quote: Predesigned shRNA in the puromycin-selectable pLKO.1 vector were obtained from Sigma Aldrich, targeting the following sequences – CTNNB1 ...
-
bioRxiv - Cell Biology 2023Quote: ... lentiviral particles harboring shRNA machinery within pSicoR-puromycin vectors were obtained from Sigma-Aldrich (scramble control ...
-
bioRxiv - Cancer Biology 2023Quote: The MISSION lentiviral-based shRNA vector collections from Sigma Aldrich (St. Louis, MO, USA) were used for long-term silencing of BRD4 ...
-
bioRxiv - Neuroscience 2023Quote: ... The shRNA construct for ARID1A (target sequence: TGGACCTCTATCGCCTCTATG, NM_006015) was obtained from Sigma (TRCN0000358749). This pLKO.1-based construct was packaged into lentiviruses ...
-
bioRxiv - Biochemistry 2024Quote: ... Induction of shRNA expression was achieved by treating cells with 1µg/ml doxycycline (Sigma) for 72 hours ...
-
bioRxiv - Cancer Biology 2024Quote: ... and two distinct shRNAs targeting human NINJ1 RNA were acquired from Sigma (TRCN0000063769, TRCN0000289088). For the overexpression of both NINJ1 and xCT ...
-
bioRxiv - Cancer Biology 2023Quote: ... Inducible shRNA expression was activated using 1 µg/mL doxycycline (hyclate D9891, Sigma Aldrich) in the culture medium ...
-
bioRxiv - Cancer Biology 2021Quote: ... HsNHE9 targeting short hairpin RNA (shRNA) (5’-CCGGCCCTCCATTAAGGAGAGTTTTT CAAGAGAAAACTCTCCTTAATGGAGGTTTTTC-3’) and scramble control (Sigma-Aldrich) (5’-CAACAAGATGAAGAGCACCAA-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: SOX4 short hairpin (sh)RNAs for lentiviral transduction were obtained from Sigma (MISSION shRNA library). We tested six shRNAs and identified the most effective two shRNAs ...
-
bioRxiv - Cancer Biology 2020Quote: ... CALCRL MISSION shRNA (shCALCRL#1, Sigma-Aldrich, Cat# TRCN0000356798; shCALCRL#2, Sigma-Aldrich, Cat# TRCN0000356736), E2F1 MISSION shRNA (Sigma-Aldrich ...
-
Hydrogen sulfide blocks HIV rebound by maintaining mitochondrial bioenergetics and redox homeostasisbioRxiv - Microbiology 2021Quote: ... we used validated pooled gene specific shRNAs from the RNAi Consortium (TRC) library (Sigma Aldrich, USA ...
-
bioRxiv - Cancer Biology 2021Quote: ... TRCN0000107538-shLBH#3 and TRCN0000107533-shLBH#4) or a non-targeting control shRNA (Sigma, SHC002V) at MOI=5 and in the presence of 8 μg/ml polybrene ...
-
bioRxiv - Cancer Biology 2022Quote: ... shRNAs targeting ERF to develop PNT2 shERFA1 and PNT2 shERFB1 were obtained from Sigma-Aldrich: TRCN000001391 ...
-
bioRxiv - Immunology 2019Quote: ... IFITM knockdown lines were generated and maintained similarly using lentiviral shRNA constructs purchased from Sigma as described previously (38).
-
bioRxiv - Microbiology 2021Quote: ... EPCRkd PLB985 cells were generated by lentiviral transduction with EPCR specific shRNAs from Sigma (TRCN0000300553). Control cells were transduced an empty vector (pLKO) ...
-
bioRxiv - Cell Biology 2022Quote: Parental Cells or cells expressing the indicated shRNA were labeled with red (PKH 26, Sigma) or green (PKH67 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Gene-specific shRNA lentiviral vectors with a pLKO.1 backbone were purchased from Sigma-Aldrich.
-
bioRxiv - Genomics 2022Quote: ... The shRNA expression vectors (with the TRC2 pLKO.5 backbone) were obtained directly from Millipore-Sigma or cloned into the empty backbone using oligonucleotides (Integrated DNA Technologies) ...
-
bioRxiv - Microbiology 2022Quote: MISSION shRNA retroviral constructs targeting AMOT was purchased from Sigma-Aldrich (Clone ID: NM_133265.1-1628s1c1). To collect viral supernatant ...
-
bioRxiv - Physiology 2023Quote: ... The non-targeting shRNA sequence used as negative control was 5’-CAACAAGATGAAGAGCACCAA-3’ (Sigma-Aldrich). Lentivirus was collected beginning 48-hrs post-transfection and concentrated with Lenti-X Concentrator (Takara Bio USA ...
-
bioRxiv - Genomics 2023Quote: Stable LATS depleted T47D cells were generated by using lentiviral shRNAs obtained from Sigma (MISSION) shRNA Lentiviral Transduction Particles ...
-
bioRxiv - Cancer Biology 2023Quote: ... and NM_001569.3-2873s1c1) and a scrambled shRNA were purchased from Sigma Aldrich (St. Louis, Missouri). Lentiviral particles were made using the pLVX Advanced plasmid system (CloneTech Laboratories Inc ...
-
bioRxiv - Developmental Biology 2023Quote: ... Rtf1 or NT (non-target) shRNA lentivirus harboring puromycin resistance were purchased from Sigma-Aldrich. mESCs were transduced with the indicated virus at a multiplicity of infection of 1 and selected in 1.2 μg/ml puromycin ...
-
bioRxiv - Cancer Biology 2024Quote: ... shRNA constructs in a pLKO.1 vector targeting human CHMP5 were purchased from Sigma Aldrich along with 2 control non-targeting shRNAs ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA silencing in this study was described previously using the MISSION shRNA Lentiviral Transduction (Sigma-Aldrich)8 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Stat3 knockdown cell lines were generated by transducing cells with lentiviral shRNA (TRCN0000071456, TRCN0000071454, TRCN0000071453, Sigma). Lentiviruses were generated using 293T cells via transfection with PEI and appropriate vectors ...
-
bioRxiv - Cell Biology 2020Quote: ... lentiviruses as well as desired shRNA viruses in NPC media containing 10 μM Thiazovivin (Millipore, #S1459) and spinfected (centrifuged for 1 hour at 1000g) ...
-
bioRxiv - Cancer Biology 2022Quote: MM cells were transduced with shRNAs or treated with 50nM everolimus (Sellekchem) or 5μM JPH203 (SIGMA) were plated onto a 15 well μ-Slide Angiogenesis ibiTreat chamber slide (Ibidi ...
-
bioRxiv - Cancer Biology 2019Quote: HKII expression was stably interfered by infecting cells with a lentivirus carrying the following shRNAs (Sigma) against mouse HKII mRNA:
-
bioRxiv - Cancer Biology 2020Quote: PLKO.1-puro constructs for knock-down of Tead1 were obtained from Sigma-Aldrich (MISSION shRNAs). Constructs were transfected into LentiX (HEK293T ...