Labshake search
Citations for Millipore Sigma :
51 - 100 of 10000+ citations for Mouse NRAP shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... pLKO.1-puro plasmids encoding scrambled shRNA and five FYCO1-targeted shRNAs were purchased from Sigma Aldrich. For details on oligonucleotides refer to (Table S1).
-
bioRxiv - Microbiology 2020Quote: The mouse Rab GTPases shRNA library (317 shRNAs) was extracted from The Mission mouse shRNA library generated by The RNAi consortium (Sigma Aldrich) and prepared as described before (Shi et al. ...
-
bioRxiv - Molecular Biology 2023Quote: Production of short hairpin RNA (shRNA)-expressing lentiviral particles was performed as described previously53 using plasmids expressing shRNAs targeting ZFC3H1 (Sigma-Aldrich MISSION shRNA, TRCN0000130498) or a non-targeting control (Addgene ...
-
bioRxiv - Immunology 2021Quote: Various lentiviral shRNA plasmids against RNH1 were purchased from Sigma and lentvirus was generated as previously described (Chennupati et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... the Mission shRNA plasmid (TRCN0000289279) was purchased from Sigma-Aldrich.
-
bioRxiv - Systems Biology 2020Quote: ... shRNA plasmid against human GEF-H1 was obtained from Sigma (clone ID ...
-
bioRxiv - Cancer Biology 2022Quote: ... KDM6B targeting human shRNA plasmid was purchased from Sigma (TRCN0000236677). Scrambled vector sh-Control (sh-C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Control shRNAs in the same plasmid were also purchased (Sigma). The IDs for the ERK5 shRNAs used are ...
-
bioRxiv - Cell Biology 2021Quote: plasmids were from the MISSION Human shRNA library (Millipore SIGMA). The pLKO.1eGFP control vectors (EV ...
-
bioRxiv - Cell Biology 2024Quote: ... pLKO.1-Neo-CMV-tGFP TIAM1 shRNA plasmid (Sigma Aldrich, Cat # 07202334MN ...
-
bioRxiv - Pathology 2024Quote: ... Pcmt1 shRNA in PLKO plasmid (GCGCTAGAACTTCTATTTGAT, TRCN0000036400, Sigma-Merck USA) was transfected into HUVECs ...
-
bioRxiv - Cell Biology 2023Quote: ... we used the MISSION shRNA lentiviral plasmids pLKO.1-puro with shRNA target sequence CCAGATGACTTGATCGGATAT (TRCN0000190340, Millipore Sigma) and pLKO.005-puro with shRNA target sequence GTTGGCCTGAACCTGCTTTAT (TRCN0000382281 ...
-
bioRxiv - Cancer Biology 2020Quote: We generated lentiviral shRNA particles for silencing mouse EphB4 (MISSION shRNA; Sigma-Aldrich TRCN0000023619 and TRCN0000023621); SHP2 (MISSION shRNA ...
-
bioRxiv - Neuroscience 2022Quote: ... we used the previously characterized Lmx1a-targeting shRNA construct (pLKO. 1-mouse Lmx1a shRNA, Sigma, TRCN0000433282) (Fregoso et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... received a non-target shRNA viral injection (NT-shRNA; SHC016: MISSION® pLKO.1-puro non-Target shRNA Control Plasmid DNA; Sigma Aldrich, St. Louis, MA, USA) to determine any effects of surgery alone on respiratory behaviour ...
-
bioRxiv - Biochemistry 2021Quote: ... 105 MA104 cells were co-transfected with the plasmid pCMV-HyPBase encoding the hyperactive variant of PiggyBac transposase56,57,22 along with the plasmid pPB[shRNA]-EGFP:T2A:Puro-U6 harbouring shRNA targeting RVA NSP2 gene using Lipofectamine 3000 (Sigma-Aldrich), following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: We purchased a MISSION shRNA vector library encoding the microRNA-adapted shRNA targeting mouse Nwd1 (Sigma-Aldrich). Among five shRNA clones (TRCN0000257630 ...
-
bioRxiv - Cancer Biology 2021Quote: The lentiviral shRNA clones targeting mouse aldolase A and nontargeting shRNA control were obtained from Sigma Aldrich in the pLKO vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... SK.N.BE2 cells were infected with TRIM67 Mission lentiviral shRNA plasmids (Sigma). For virus production ...
-
bioRxiv - Microbiology 2023Quote: ... pPAX2 and pLKO.1-puro shRNAs expressing plasmids (MISSION, Sigma-Aldrich). Produced lentiviruses were concentrated and quantified as previously ...
-
bioRxiv - Physiology 2024Quote: ... Plasmids containing these shRNAs were obtained from Sigma (St. Louis, MO). We determined that the targeting sequence CCGTCCCTACATGGATGAAAT was most efficient in knocking down mTOR in primary human trophoblast cells ...
-
bioRxiv - Cancer Biology 2019Quote: Control pLKO.1-LacZ shRNA and four different lentiviral shRNA pLKO.1 plasmids designed to silence DARPP-32 protein expression were purchased from Sigma. To prepare the lentivirus ...
-
bioRxiv - Microbiology 2023Quote: ... HEK293FT cells were transfected with 1μg of TRC-pLKO.1-Puro plasmid containing either non-targeting shRNA (CAACAAGATGAAGAGCACCAA) or ATF4-targeted shRNA (GCCTAGGTCTCTTAGATGATT) (Sigma-Aldrich), together with 1 μg mixture of packaging plasmids (pMD2.G and psPAX2 ...
-
bioRxiv - Molecular Biology 2020Quote: For shRNA transduction, individual shRNAs targeting mouse Arid1a (TRCN0000238303, shArid1a-#1; TRCN0000238306, shArid1a-#5) were obtained from Sigma Mission shRNA library (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2020Quote: ... Lentivirus expressing shRNAs targeting mouse Irf7 transcripts (Irf7 shRNA1, Sigma TRCN0000077292 and Irf7 shRNA2 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The Mouse Ulk4 shRNA lentiviral vector was purchased from Sigma (TRCN0000328268 for Ulk4 knockdown in NIH3T3 cells and MEFs;TRCN0000002203 for Ulk4 knockdown in HEK293 cells) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1.6 µg of DNA per well with the GFP-LC3B expression plasmids with or without scrambled shRNA or a mixture of five FYCO1-targeting shRNAs (Sigma Aldrich). The efficiency of shRNAs targeting Fyco1 in mouse cells were verified in N2A neuroblastoma cells (Figure S4D) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Non-targeting control pLKO shRNA lentivirus plasmid (MISSION, SHC002) was kindly provided by Tianyan Gao and pLKO shRNAs targeting PTP4A3 were purchased from Sigma-Aldrich; target sequences are listed in Supplemental Table 2.
-
bioRxiv - Neuroscience 2020Quote: ... a modified pLKO.5 vector containing shRNA expression cassettes targeting syt1 (TRCN0000093258) and syt9 (TRCN0000379591) from Mission shRNA plasmids (Sigma-Aldrich) was used.
-
bioRxiv - Cancer Biology 2023Quote: ... Stable KD of EIF4G2 was generated by infecting HEC-1A or RL95-2 cells with lentiviruses harboring pLKO.1-puro plasmid expressing shRNA targeting GFP (Control) or shRNA targeting EIF4G2 (Sigma TRCN0000147914), followed by selection using puromycin ...
-
bioRxiv - Cell Biology 2024Quote: ... individual ACVRL1-targeting short hairpin-RNA (shRNA) clones (Table 1) were inserted into the MISSION® 3X-LacO Inducible shRNA plasmid backbone (Sigma). Both clones target a similar region in the ACVRL1 transcript and produced similar levels of knockdown ...
-
bioRxiv - Cancer Biology 2020Quote: ... cloned into the pLKO.1 puro-vector (MISSION® shRNA plasmids, Sigma), were used ...
-
bioRxiv - Cancer Biology 2022Quote: As lentiviral shuttle backbone we used a pLKO shRNA plasmid (Mission SIGMA). As control we used pLKO shRNA empty expression vectors ...
-
bioRxiv - Immunology 2022Quote: ... pLKO.1 plasmids either containing the shRNA sequence: CCGGGCAGAAGATATTCACAGACATCTCGAGATGTCTGTGAATATCTT-CTGCTTTTTTG (TRCN0000148136, SIGMA) or the scrambled shRNA sequence ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plasmid encoding the shRNA against CDT1 was from Sigma-Aldrich (TRCN0000174484). The CDT1-pCDNA3 plasmid is described in Coulombe et al.42.
-
bioRxiv - Immunology 2020Quote: Plasmid included Mission® pLKO-puro Non-Target shRNA (Sigma-Aldrich, #SHC016V), pLKO shRNA targeting BBS1 (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... and the non-target control shRNA plasmid were purchased from Sigma-Aldrich. Lentivirus-containing supernatants were collected ...
-
bioRxiv - Neuroscience 2023Quote: ... shRNA plasmids were cloned by the insertion of the siRNA sequences (Sigma) shown to be effective against Ncan mRNA (Okuda et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... shRNA plasmids were cloned by the insertion of the siRNA sequences (Sigma) shown to be effective against Ncan mRNA (Okuda et al. ...
-
bioRxiv - Immunology 2020Quote: ... The pLKO vectors either encoded two specific shRNAs against mouse Akt1 (Cat# TRCN0000304683) or a non-silencing control shRNA sequence (Cat# SHC002) (all from Sigma). Akt1 shRNA and control non-silencing shRNA viruses were intratracheally instilled in mice in a volume of 50 µl ...
-
bioRxiv - Cell Biology 2020Quote: ... VAMP7 shRNA (Sigma-Aldrich, Mission shRNA, TRCN0000059892), Rab6 shRNA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... GMAP210 shRNA (Sigma-Aldrich, Mission shRNA, TRCN0000022021), VAMP7 shRNA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... Rab6 shRNA (Sigma-Aldrich, Mission shRNA, TRCN0000379588), and Synt16 shRNA (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... or SERPINB3 shRNA (Sigma Mission shRNA, TRCN0000052400). Genetically modified cells were generated through a lentivirus system by transfection of human 293T packaging cells ...
-
bioRxiv - Cell Biology 2020Quote: ... MDN1 and mouse Prmt1 were the validated MISSION shRNAs (Sigma-Aldrich). The shRNAs were TRCN0000290479 (human PRMT1) ...
-
bioRxiv - Cell Biology 2024Quote: ... we obtained a shRNA sequence targeting mouse ARG1 from Sigma-Aldrich Mission RNAi (TRCN0000101796) ...
-
bioRxiv - Immunology 2019Quote: ... Mul1 shRNA lentiviruses (shMul1) were prepared using commercial plasmids (TRCN0000040742 and TRCN0000328514, Sigma); TRCN0000040742 ...
-
bioRxiv - Cell Biology 2021Quote: MLK3-shRNAs in lentiviral vector pLKO.1-Puro plasmids were obtained from Sigma. Other plasmids used for lentivirus production were purchased from Addgene ...
-
bioRxiv - Neuroscience 2020Quote: Pre-validated shRNA plasmids were identified on the Broad Institute RNAi Consortium shRNA Library Database and purchased from Sigma-Aldrich (St. Louis, MO). Multiple shRNA plasmids were tested by immunostain analysis of Nav1.1 density (see Supplemental Figure 5 for validation data) ...
-
bioRxiv - Cell Biology 2023Quote: ... from the pLKO1.puro plasmid were generated with the targeting sequence of the ITCH gene AACACCTCGAGACAACCTC (shEE162) and the shRNA control CAACAAGATGAAGAGCACCAA (Sigma MISSION Target shRNA). Selection was carried out using 1µg/ml of puromycin for 48 hours ...