Labshake search
Citations for Millipore Sigma :
201 - 250 of 10000+ citations for Mouse CSRNP1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... or MARK3 shRNA (Sigma, TRCN0000001564) were packaged into lentivirus by VectorBuilder ...
-
bioRxiv - Developmental Biology 2024Quote: ... shRNAs were bought from Sigma’s Mission Library (TRCN0000263127 and TRCN0000282500) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and non-targeting control shRNA (pLKO.1-puro non-Target shRNA Control; referred to as shCtrl) were obtained from Sigma (MISSION® shRNA Library), amplified ...
-
bioRxiv - Cancer Biology 2020Quote: ... two short hairpin RNAs (shRNA) targeting SLX4IP in the pLKO.1-puro lentiviral expression plasmid were purchased from Sigma (Clone ID NM_001009608.1-426s1c1 and NM_001009608.1-247s1c1) ...
-
bioRxiv - Microbiology 2020Quote: ... MDMs were transfected with plasmids that encoded either a mixture of three to five shRNAs directed against IRF8 (Sigma) or a mixture of control shRNAs (Sigma ...
-
bioRxiv - Molecular Biology 2020Quote: ... The total RNA was isolated from the hepatic cells grown after successful transfection of the plasmids containing shRNA molecules against both target genes as per the manufacturer’s protocol using Trizol (Sigma). The RNA samples were treated with DNase I (Fermentas ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 μg of Endonuclease G shRNA plasmid was transfected using linear/branched PEI (Polyethylenimine) polymer (Sigma, 1 mg/ml) (Longo et al. ...
-
bioRxiv - Cell Biology 2022Quote: Transfer plasmids with pre-designed shRNA against human Cdc42 mRNA were obtained from the Mission® TRC library (Sigma). Specifically ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLKO.1-puro shRNA plasmid DNA was isolated from bacteria glycerol stocks (IFNAR1: TRCN0000301483, PD-L1: TRCN0000068001; Sigma Aldrich) using E.Z.N.A.® Plasmid Mini Kit I (Omega Bio-tek ...
-
bioRxiv - Immunology 2023Quote: Protein expression was stably knocked down in Jurkat T cells by RNA interference using Mission shRNA plasmids (Sigma-Aldrich). Lentiviral particles were generated by transfecting HEK293T cells with pMD2G ...
-
bioRxiv - Cancer Biology 2024Quote: The shRNA plasmid (pLKO.1) for TP53 (TRCN0000003754) and TRIM28 (TRCN0000017998) were obtained from the TRC library (Sigma, IISc). The TRIM28 3’ UTR Luc vector plasmid was purchased from Origen ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 5μg lentiviral expression constructs shRNA (pLKO.1 Mission shRNA DNA clone, Sigma-Aldrich Inc.) or shMCU (#SHCLNG-NM_138357 Mission shRNA ...
-
bioRxiv - Cell Biology 2020Quote: ... non-target shRNA (SHC002) and eIF4E shRNA (SHCLND-NM_001968) and were purchased from Sigma Aldrich. shRNA to human raptor (plasmid#1857) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Stable lentiviral vectors expressing shRNA targeting MSI2 and control shRNAs were obtained from Sigma Aldrich (Mission lentiviral system ...
-
bioRxiv - Cell Biology 2021Quote: ... Lentiviral shRNA clones targeting Mapk6 and Makpakp5 were from the TRC1 shRNA library (Sigma-Aldrich): TRCN0000023199 for Mapk6 and TRCN0000024197 for Makpakp5 ...
-
bioRxiv - Cell Biology 2020Quote: ... Lamin B1 shRNA was expressed from pLKO.1 shRNA-LMNB1.71 puro (SHCLND-NM_005573, Sigma-Aldrich) containing the sequence ...
-
bioRxiv - Neuroscience 2022Quote: ... Silencing constructs encoding control shRNA and mfn2 shRNA (target sequence: TGGATGGACTATGCTAGTGAA) were purchased from Sigma (SHC202 and TRCN0000080612 respectively) ...
-
bioRxiv - Cancer Biology 2023Quote: PDA530Met cells were transduced with control Scr shRNA (Non-Mammalian shRNA Control, SHC002, Sigma-Aldrich) or two independent shRNAs directed against the target gene ...
-
bioRxiv - Cell Biology 2023Quote: ... The following shRNAs were used in this study: Non-Targeting shRNA Controls (Sigma, Cat. # SHC002), shZNF598#1 (Sigma ...
-
bioRxiv - Cancer Biology 2024Quote: ... shRNAs that stably integrated into mouse cells were chosen through selection with 10 μg/ml puromycin (Sigma). For the generation of Nat10-overexpressing cells ...
-
bioRxiv - Evolutionary Biology 2021Quote: The HIV-derived lentiviral vector pLKO.1 containing shRNAs (TRIM17 MISSION shRNA Bacterial Glycerol Stock, Sigma) that targeted Trim17 (shTrim17-1 ...
-
bioRxiv - Cell Biology 2021Quote: Control or Myo10 shRNA knockdown C2C12 lines were made using MISSION shRNA lentiviral particles (Sigma-Aldrich No ...
-
bioRxiv - Cell Biology 2021Quote: ... 4EBP1 shRNA (TRCN0000335449) and EIF4G1 shRNA (TRCN0000096812) targeting the Coding Sequence (CDS) were all from Sigma. Lentiviral backbone pLV-EF1a-IRES-Neo was a gift from Tobias Meyer (Addgene plasmid #85139) ...
-
bioRxiv - Immunology 2021Quote: shRNA clones were obtained from the whole RNAi human library for shRNA mediating silencing (Sigma, Aldrich) maintained at IISER ...
-
bioRxiv - Cancer Biology 2023Quote: shRNA constructs targeting METTL3 and control shRNA in the pLKO.1 vector were procured from Sigma. To generate lentiviral particles for each shMETTL3 and control shRNA construct ...
-
bioRxiv - Neuroscience 2020Quote: ... Mission ShRNA bacterial Glycerol stock NM_026582) and scramble control (Mission TRC2 PlkO.5-PURO Non-Mammalian shRNA control Plasmid) were purchased from Sigma-Aldrich. Wnt3a plasmid pLCN-Wnt3a-HA (Addgene ...
-
bioRxiv - Molecular Biology 2019Quote: ... HEK293T were plated at 50% confluency on 60 mm dishes and transiently transfected with the gene specific shRNA pLKO.1 plasmid (Sigma), packaging plasmid (Δ8.9 ...
-
Cell culture dimensionality influences mesenchymal stem cell fate through cadherin-2 and cadherin-11bioRxiv - Cell Biology 2019Quote: pLKO.1 plasmids containing short hairpin RNA (shRNA) sequences targeting cadherin-11 or cadherin-2 were obtained from Sigma-Aldrich together with a scrambled negative control ...
-
bioRxiv - Cancer Biology 2020Quote: ... lentiviral vectors expressing the shRNA targeting PAT4 were produced as follows: HEK293T cells were co-transfected with shRNA-PAT4 plasmid DNA (5’-CCGGCCTTGATAAATGAGCAGAATTCTCGAGAATTCTGCTCATTTATCAAGGTTT TTG-3’; TRCN0000043984; Sigma) or new shRNA lentivirus (GTTGTCCTTATTGGAGATTC ...
-
bioRxiv - Molecular Biology 2020Quote: Lentiviral-mediated shRNA knockdown was carried out as described previously (Cui et al., 2012) with plasmids encoding shRNA against RanBP2 (shRNA1: TRCN0000003452, shRNA3: TRCN0000003454, Sigma), AGO1 (shRNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... Viral vectors for shRNA expression as well as empty-cassette plasmids used as vector controls were obtained from the Mission TRC library (Sigma) via the McGill Platform for Cellular Perturbation (clone information and sequences in Supplementary Table 2) ...
-
bioRxiv - Cancer Biology 2019Quote: ... cells were transfected with 0.5 µg/well of pLKO.1-puro Vector empty or with plasmids containing the target shRNA sequence for the indicated kinases (Mission Library, Sigma). 48h after transfection ...
-
bioRxiv - Cell Biology 2020Quote: Silencing of MASTL and TSC2 was performed using pLKO.1 lentiviral plasmids encoding specific siRNA (ON-TARGET SMARTpool, Dharmacon) or shRNA sequences (Sigma), as previously described 59 ...
-
bioRxiv - Cell Biology 2020Quote: ... pLKO.1 Fbxo45 shRNA plasmids shFbxo45b (TRCN0000201180, target sequence GACATGGAGGATAAGACTTTA) and shFbxo45a (TRCN0000339817 target sequence TGGAATCTGGTGGACAATAAT) were obtained from Sigma. When co-transfected with Flag-Fbxo45 ...
-
bioRxiv - Molecular Biology 2021Quote: ... HEK293T were plated at 50% confluency on 60 mm dishes and transiently transfected with the gene specific shRNA pLKO.1 plasmid (Sigma), packaging plasmid (Δ 8.9 ...
-
bioRxiv - Physiology 2023Quote: Glycerol stocks of pLKO.1-puro lentiviral plasmid vectors containing shRNA targeting human Nup93 (NM_014669) and an empty vector insert (shEmpty) were purchased from Sigma-Aldrich. Lentivirus expressing shNup93 or shEmpty were generated by PEI-mediated co-transfection of pLKO.1-puro ...
-
bioRxiv - Cell Biology 2024Quote: ... HEK293T were plated at 40% confluency on 60 mm dishes and transfected with the gene specific shRNA pLKO.1 plasmid (Sigma), packaging plasmid (Δ8.9 ...
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293T were plated at 50% confluency on 60 mm dishes and transiently transfected with the gene specific shRNA pLKO.1 plasmid (Sigma), packaging plasmid (Δ8.9 ...
-
bioRxiv - Biophysics 2021Quote: ... A non-targeting shRNA (Sigma SHC216) was used as a control.
-
bioRxiv - Immunology 2021Quote: ... or control shRNAs for GFP (Sigma) and luciferase (Sigma ...
-
bioRxiv - Developmental Biology 2020Quote: pLKO1 vector containing shRNA (Sigma Aldrich) and H2b-GFP plasmids (gift from Elaine Fuchs ...
-
bioRxiv - Biochemistry 2019Quote: ... the most effective shRNA (TRCN0000007273; Sigma) for lentiviral infection were used for experiments ...
-
bioRxiv - Cancer Biology 2019Quote: ... pLKO.1-non-targeting shRNA (Sigma; 5’- CCT AAG GTT AAG TCG CCC TCG CTC GAG CGA GGG CGA CTT AAC CTT AGG -3’) ...
-
bioRxiv - Cancer Biology 2020Quote: ... non-mammalian shRNA sequences (Sigma SHC002) were cloned into Tet-pLKO-puro vectors by using oligo (5’-3’) ...
-
bioRxiv - Neuroscience 2020Quote: ... non-targeted shRNA (SHC016, Sigma-Aldrich), or empty vector plko.1 lentivirus ...
-
bioRxiv - Cancer Biology 2021Quote: Mission shRNA vectors purchased from Sigma were transiently transfected along with pCMV-VSVG and ps-PAX2 into HEK 293T cells using polyethylenimine (PEI ...
-
bioRxiv - Cancer Biology 2022Quote: ... shRNAs targeting ERF (Sigma-Aldrich: TRCN000001391) and lentiviral GFP-tagged ERF (GeneCopoeia ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLKO.1 HIF2α shRNA (#TRCN0000082307, Sigma).
-
bioRxiv - Biochemistry 2020Quote: ... The shRNAs used were from Sigma shRNA clone library which were identified by TRC numbers.
-
bioRxiv - Cancer Biology 2021Quote: ... Vectors encoding for random shRNA (Sigma) were used as a control ...