Labshake search
Citations for Millipore Sigma :
501 - 550 of 787 citations for ICOS Rhesus Macaque HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... supplemented with 10% FCS (PAN-Biotech, P40-37500) and 1% penicillin/streptomycin (Sigma, P0781-20ML) at 37°C with 5% CO2 ...
-
bioRxiv - Immunology 2019Quote: ... Cells were washed with FACS buffer (PBS, 2%FCS) and fixed in 4% Paraformaldehyde (Sigma) in PBS for 10 minutes ...
-
bioRxiv - Bioengineering 2021Quote: ... Cells were cultured in MEM-Alpha (Biological Industries) supplemented with 10% Heat Inactivated FCS (Sigma), 50IU rhIL-2 (Peprotech ...
-
bioRxiv - Molecular Biology 2020Quote: ... and anti-Human IgG (Fc specific) −Peroxidase antibody produced in goat was from Sigma-Aldrich. Two TNFα-antagonists were purchased ...
-
bioRxiv - Molecular Biology 2022Quote: ... The media were supplemented with 10% FCS and 1% penicillin-streptomycin (Sigma-Aldrich, Taufkirchen, Germany). Cells were maintained at 37°C in a 5% CO2 atmosphere ...
-
bioRxiv - Immunology 2020Quote: ... 200 μl MTT mix (DMEM supplemented with 10% FCS containing 250μg/ml tetrazolium bromide, Sigma) was added to each well ...
-
bioRxiv - Neuroscience 2020Quote: ... supplemented with 10% FCS (PAN-Biotech, P40-37500) and 1% penicillin/streptomycin (Sigma, P0781-20ML). Medium was changed every three days until adult microglia were treated as indicated after 8 days in vitro (DIV).
-
bioRxiv - Neuroscience 2020Quote: ... supplemented with 10% FCS (PAN-Biotech, P40-37500) and 1% penicillin/streptomycin (Sigma, P0781-20ML) at 37°C with 5% CO2 ...
-
bioRxiv - Immunology 2022Quote: ... SMGs were digested in 500μl RPMI-1640 containing 5% fetal calf serum (FCS; Sigma Aldrich), 6µl Collagenase-II (23mg/mL ...
-
bioRxiv - Biophysics 2019Quote: ... with the addition of 10 mM HEPES and 0.5% fetal calf serum (FCS, Sigma-Aldrich) was used if not stated otherwise ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with 10% fetal calf serum (FCS, Biowest) and 1% Penicillin–Streptomycin (PS, Sigma-Aldrich) at 37 °C and 5% CO2 in a humidified incubator.
-
bioRxiv - Cell Biology 2020Quote: ... and re-suspended in ice cold 2 % (v/v) FCS/PBS (PAA Laboratories/Sigma Aldrich) following centrifugation ...
-
bioRxiv - Immunology 2020Quote: ... Cells were resuspended in flow cytometry buffer (FB: 2% FCS, 3 nM EDTA (Sigma, E9884) in PBS) ...
-
bioRxiv - Immunology 2021Quote: ... 107 BAL cells per mL were suspended in 90% FCS and 10% DMSO (Sigma-Aldrich) and cryopreserved in liquid nitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 μL of goat anti-human IgG (Fc specific)-Peroxidase antibody (1 : 5000 dilution, Sigma) was added and incubated for another 1 h at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were differentiated into macrophages in complete media (RPMI, Gibco + FCS, Gibco +1%Penstrep, Sigma) containing 5% FCS and additional 100ng/mL M-CSF (PeproTech ...
-
bioRxiv - Biophysics 2023Quote: ... The anti-human Fc capturing mAb (GG-7) was from Sigma-Aldrich (St. Louis, MO). LIBS-2 was purchased from EMD Millipore (Billerica ...
-
bioRxiv - Cancer Biology 2022Quote: ... MDA-MB-231 and BrM cells were cultured in 10% (v/v) FCS (Sigma-Aldrich)-supplemented RPMI-1640 (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2023Quote: ... 100 µL of anti-human IgG (Fc specific)-peroxidase antibody produced in goat (Sigma, A0170) was added to each sample in a 1:40,000 dilution of PBS and incubated for 1 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... Appropriate secondary antibodies (IgG-Fc Specific-Peroxidase) of mouse or rabbit origin (Sigma-Aldrich Inc.) were used ...
-
bioRxiv - Microbiology 2023Quote: ... supplemented with 10% heat-inactivated fetal calf serum (FCS, Sigma-Aldrich, St. Louis, MO, USA) and 120 µg/ml gentamicin (Refobacin ...
-
bioRxiv - Cancer Biology 2020Quote: HEK293-T cells were transiently transfected with GFP-V5 or GREP1-V5 fusion proteins using OptiMem and Fugene HD (Sigma-Aldrich, St. Louis, MO). 72 hours after transfection ...
-
bioRxiv - Cancer Biology 2022Quote: ... Media were collected from HEK293 cells 48 hours after transfection and used for transductions in a final concentration of 8 ug/mL polybrene (Sigma-Aldrich, cat. TR-1003). Selection and maintenance of transduced cells was achieved with 5 ug/mL puromycin (Gibco ...
-
bioRxiv - Biophysics 2023Quote: ... and human embryonic kidney 293 (HEK293) cells were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA) and maintained in DMEM (D5796, Sigma-Aldrich, St. Louis, MO), which was supplemented with 10% FBS (12676029 ...
-
bioRxiv - Cell Biology 2023Quote: ... to validate the gene expression the plasmid (vide-supra) was transfected into HEK293 cells using PEI (Sigma-Aldrich/Merck Cat. No. 49553-93-7) following an optimized version of the standard protocol(Rajendra ...
-
Shear stress and very low levels of ligand synergize to activate ALK1 signaling in endothelial cellsbioRxiv - Cell Biology 2023Quote: ... tccagagaagcctaaagtgat) or non-targeted control (shCont, Cat: SHC002) were generated in HEK293 cells using the Sigma Mission system (Sigma-Aldrich, St. Louis, MO USA). HUVECs were seeded into a 6-well dish at a density of 80,000 cells per well ...
-
bioRxiv - Molecular Biology 2020Quote: ... Injection capillaries (PIEZO 8-15-NS, Origio, Charlottesville, USA) were filled with Fluorinert (FC-770, Sigma) for proper Piezo pulse propagation ...
-
bioRxiv - Biochemistry 2022Quote: ... HMEC are maintained in 10% FCS/Pen-Strep MCDB media supplemented with 2mM L-Glutamine (Sigma), EGF (2ng/ml ...
-
bioRxiv - Genetics 2020Quote: ... supplemented with 10 % (w/v) fetal calf serum (FCS)(PAA) and 2 mM L-glutamine (Sigma) at 37 °C with 5 % CO2 and saturated humidity ...
-
bioRxiv - Bioengineering 2021Quote: ... Four different target Fc-proteins were used in this study: hIgG (Sigma-Aldrich, St. Louis, MO), plant-expressed rCMG2-Fc ...
-
bioRxiv - Cancer Biology 2021Quote: ... supplemented with 10% fetal calf serum (FCS; PAA, Linz, Austria) and 2 mm glutamine (Sigma Aldrich). Cells were selected for acquired drug resistance over several months via exposure to increasing concentrations of oxaliplatin or BOLD-100/KP1339 followed by drug-free recovery phases ...
-
bioRxiv - Cancer Biology 2019Quote: ... cells were incubated with FITC-conjugated goat anti-human IgG (Fc specific) (Sigma St-Louis, MI) or FITC-conjugated goat anti-mouse IgG (H+L ...
-
bioRxiv - Cell Biology 2021Quote: ... S2R+ Cells (2 × 105) were seeded in Schneider medium plus 10% FCS (Gibco 21720024, Sigma F9665) in a 24-well plate ...
-
bioRxiv - Immunology 2022Quote: ... in PBS and stored in washing buffer (PBS+5%FCS+0.2% Triton X-100 (Sigma-Aldrich)+0.01% Thimerosal (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2021Quote: ... Proteinase K activity was blocked by the addition of 20% foetal bovine serum (FCS) (F7524, Sigma) followed by rinsing in R16 medium ...
-
bioRxiv - Biochemistry 2020Quote: ... ScFv-hFc or IgG were detected using goat-anti-hIgG(Fc)-HRP (1:70000, A0170, Sigma). Titration assays were performed using 384 well microtiter plates (Costar ...
-
bioRxiv - Cell Biology 2021Quote: ... University of Utrecht) were maintained in DMEM supplemented with 10% fetal calf serum (FCS; Sigma A7906) and 100 U/ml Pen/100 μg/ml Strep (Gibco ...
-
bioRxiv - Developmental Biology 2020Quote: ... spinal cords were overlaid with 3ml of F12 medium supplemented with 10% FCS (F7524; Sigma-Aldrich), 1% Penicillin/Streptomycin (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2022Quote: ... diluted 1:1 000 with secondary antibody Anti-Mouse IgG (Fc specific) HRP (Sigma-Aldrich #A0168) diluted 1:5 000 ...
-
bioRxiv - Developmental Biology 2022Quote: ... They were cultured in FC supplemented with 1 μg ml-1 heparin (Sigma-Aldrich H3149-25KU), and 25 ng ml-1 FGF4 (R&D Systems 7486-F4-025 ...
-
bioRxiv - Cancer Biology 2023Quote: ... mice were intraperitoneally injected with 250 mg/kg 5-fluorocytosine (5-FC) (Sigma Aldrich, Cat: F71291G), and after 12 hours ...
-
bioRxiv - Immunology 2023Quote: ... Cells were washed and resuspended in RPMI 1640/FCS with 50 μM 2-mercaptoethanol (Sigma-Aldrich) at concentration of 106 cells/ml ...
-
bioRxiv - Microbiology 2023Quote: ... The infected cells were cultured in DMEM with 10% FCS and 2μg/ml of cycloheximide (Sigma) for 24h ...
-
bioRxiv - Immunology 2023Quote: ... The cell pellet was resuspended in RPMI medium (Capricorn, RPMI-STA) containing 10 % FCS (Sigma, F7524). Before expansion ...
-
bioRxiv - Cell Biology 2023Quote: ... Secreted JAGGED1-Fc was recovered from the culture media on Protein A agarose (Millipore, 16-125) and eluted with 100 mM glycine ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were frozen in DMEM+FCS+Pen/Strep supplemented with 20% FICOL-PM400 (Sigma, F4375-25G) as a cryoprotectant ...
-
bioRxiv - Cell Biology 2023Quote: ... FC and DN ARF6 for 24 hours were lysed in RIPA buffer (EMD Millipore, 20-188) containing protease inhibitors ...
-
bioRxiv - Molecular Biology 2023Quote: ... supplemented with 10% FCS (Eurobio Scientific, CVFSVF00-01) and containing 1% penicillin-streptomycin (Sigma-Aldrich, P4333). All cells were grown in a humidified incubator at 37°C with 5% CO2.
-
bioRxiv - Developmental Biology 2024Quote: ... Cells were resuspended in 10% FCS/PBS and fixed either with 1% PFA (Sigma-Aldrich #252549) for ChIP-seq or with 2% PFA for C-HiC for 10 minutes rolling ...
-
bioRxiv - Cell Biology 2024Quote: Human cells (HeLaK and Hek293T) were cultured in DMEM (Biowest) supplemented with 10% FCS (Sigma-Aldrich) at 37°C and 5% CO2 ...