Labshake search
Citations for Millipore Sigma :
551 - 600 of 4287 citations for Human UFL1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: MISSION shRNA retroviral constructs targeting AMOT was purchased from Sigma-Aldrich (Clone ID: NM_133265.1-1628s1c1). To collect viral supernatant ...
-
bioRxiv - Physiology 2023Quote: ... The non-targeting shRNA sequence used as negative control was 5’-CAACAAGATGAAGAGCACCAA-3’ (Sigma-Aldrich). Lentivirus was collected beginning 48-hrs post-transfection and concentrated with Lenti-X Concentrator (Takara Bio USA ...
-
bioRxiv - Genomics 2023Quote: Stable LATS depleted T47D cells were generated by using lentiviral shRNAs obtained from Sigma (MISSION) shRNA Lentiviral Transduction Particles ...
-
bioRxiv - Cancer Biology 2023Quote: ... and NM_001569.3-2873s1c1) and a scrambled shRNA were purchased from Sigma Aldrich (St. Louis, Missouri). Lentiviral particles were made using the pLVX Advanced plasmid system (CloneTech Laboratories Inc ...
-
bioRxiv - Developmental Biology 2023Quote: ... Rtf1 or NT (non-target) shRNA lentivirus harboring puromycin resistance were purchased from Sigma-Aldrich. mESCs were transduced with the indicated virus at a multiplicity of infection of 1 and selected in 1.2 μg/ml puromycin ...
-
bioRxiv - Biochemistry 2021Quote: Human IgM purified from human serum (Sigma) was digested with trypsin ...
-
bioRxiv - Molecular Biology 2020Quote: The 3×Flag-CPEB3 plasmid was generated by subcloning the PCR-amplified human CPEB3 cDNA into the p3×FLAG-CMV 10 vector (Sigma-Aldrich). The human CPEB3 cDNA was synthesized using the indicated primers ...
-
bioRxiv - Cancer Biology 2022Quote: ... Ubi:caSMAD3 was cloned by PCR amplifying human constitutively active SMAD3 from Smad3 pCMV-SPORT6 (Harvard Plasmid Repository #HSCD00339271, Boston, MA, USA)(Sigma 11732641001), gel purifying (Qiagen #28604 ...
-
bioRxiv - Microbiology 2021Quote: ... Putative ligand proteins (elastin from human skin, fibrinogen from human plasma, laminin from human placenta, fibronectin from human plasma) (all from Sigma) were resuspended in carbonate-bicarbonate buffer (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA silencing in this study was described previously using the MISSION shRNA Lentiviral Transduction (Sigma-Aldrich)8 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Stat3 knockdown cell lines were generated by transducing cells with lentiviral shRNA (TRCN0000071456, TRCN0000071454, TRCN0000071453, Sigma). Lentiviruses were generated using 293T cells via transfection with PEI and appropriate vectors ...
-
bioRxiv - Microbiology 2020Quote: ... Lentivirus expressing shRNAs targeting mouse Irf7 transcripts (Irf7 shRNA1, Sigma TRCN0000077292 and Irf7 shRNA2, Sigma TRCN0000077289) were generated using the Mission PLKO.1 lentivirus system from Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... lentiviruses as well as desired shRNA viruses in NPC media containing 10 μM Thiazovivin (Millipore, #S1459) and spinfected (centrifuged for 1 hour at 1000g) ...
-
bioRxiv - Cancer Biology 2022Quote: MM cells were transduced with shRNAs or treated with 50nM everolimus (Sellekchem) or 5μM JPH203 (SIGMA) were plated onto a 15 well μ-Slide Angiogenesis ibiTreat chamber slide (Ibidi ...
-
bioRxiv - Cancer Biology 2019Quote: HKII expression was stably interfered by infecting cells with a lentivirus carrying the following shRNAs (Sigma) against mouse HKII mRNA:
-
bioRxiv - Cancer Biology 2020Quote: PLKO.1-puro constructs for knock-down of Tead1 were obtained from Sigma-Aldrich (MISSION shRNAs). Constructs were transfected into LentiX (HEK293T ...
-
bioRxiv - Molecular Biology 2022Quote: The PLK0 lentivirus expressing scramble (SHC002) and UBC9 (NM_003345.3-545S1C1) shRNA expressing vectors were from Sigma. Viral particles were produced and used to transduce HL60 cells as described previously (30) ...
-
bioRxiv - Cancer Biology 2022Quote: ... CGGGACAATGTGTATTACTAT) or non-targeting shRNA (CTL) in the pLKO.1-puro vector (MISSION library, Sigma-Aldrich), and selection with 2 μg/mL puromycin 3-7 days after infection ...
-
bioRxiv - Microbiology 2020Quote: THP-1 were transduced with lentivirus expressing shRNA targeting Rab29 (TRCN0000299449; TRCN0000303685; TRCN0000381042; TRCN0000303621 Sigma-Aldrich) or Rab32 ...
-
bioRxiv - Cancer Biology 2019Quote: ... pLKO.1-puro Vector empty or containing the target shRNA sequence for PIKCδ (Mission Library, Sigma) were transfected using 4-D electroporator (LONZA) ...
-
bioRxiv - Immunology 2019Quote: ... A PLKO.1 vector encoding shRNA for a negative control (Sigma-Aldrich, St. Louis, MO, USA) or a specific target molecule (Sigma-Aldrich ...
-
bioRxiv - Immunology 2020Quote: ... A PLKO.1 vector encoding shRNA for a negative control (Sigma-Aldrich, St. Louis, MO, USA) or a specific target molecule (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2019Quote: ... shRNA specific for hERG1b 5’-CCACAACCACCCTGGCTTCAT-3’ and its respective control were purchased from Sigma-Aldrich. For heterologous expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... and the transcription of shRNAs was induced with 2.0 μg/mL doxycycline hyclate (Sigma-Aldrich, #D9891).
-
bioRxiv - Biochemistry 2024Quote: ... lentivirus was generated by cotransfection of pLKO.1 with shRNA sequences specific to ACSS2 (TRCN0000045563, Millipore), pCMV-dR8.2,and pMD2.G plasmids into HEK293T cells ...
-
bioRxiv - Immunology 2020Quote: ... or human (1:20000; anti-human IgG; Sigma) for 1 hour at room temperature ...
-
bioRxiv - Cancer Biology 2021Quote: ... The MISSION shRNAs in the pLKO.1 lentiviral vector with a puromycin resistance gene were from Sigma. Product identification numbers for each shRNA are listed – NT-sh ...
-
bioRxiv - Cell Biology 2020Quote: ... A549 cells were infected with PKCε shRNA Mission® lentiviral transduction particles (catalog # SHCLNM_005400) from Sigma-Aldrich according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... Nav1.5-shRNA cells and cells non-targeting shControl cells were maintained in G418 (4 μl/ml, Sigma), blasticidin (2 μl/ml ...
-
bioRxiv - Cancer Biology 2020Quote: pLKO.1-puro lentiviral vectors expressing shRNAs targeting FASN (shFASN_1: NM_004104.x-1753s1c1 and shFASN_2: NM_004104.x-3120s1c1) were purchased from Sigma-Aldrich. An mCherry-LC3B lentiviral vector was kindly provided by Dr ...
-
bioRxiv - Neuroscience 2021Quote: ... or non-targeting control in the pLKO.1 vector were obtained from the Mission shRNA Library (Sigma).
-
bioRxiv - Cell Biology 2021Quote: NFIC expression was interfered in 266-6 cells using Mission shRNA lentiviral constructs purchased from Sigma-Aldrich. Nfic sh1 [TRCN0000374154 targeting ACAGACAGCCTCCACCTACTT) ...
-
bioRxiv - Cell Biology 2021Quote: ... The AURKA-specific shRNA (SHCLNG-NM_003600) and a non-targeting control (SHC002) were purchased from Sigma-Aldrich. Plasmids and shRNAs were transfected by the calcium phosphate method or with Lipofectamine 2000 (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... as well as pLKO.1 (50) containing either non-targeting or IFIT1 shRNA (Sigma, TRC1, Clone: TRCN0000158439). Huh7 cells were transduced with the indicated shRNA expressing lentivirus then selected with 2 μg/ml puromycin (Sigma) ...
-
bioRxiv - Immunology 2022Quote: ... All lentiviral vectors (pLKO.1) expressing shRNAs used for knockdown of host proteins were purchased from Sigma.
-
bioRxiv - Cell Biology 2019Quote: MISSION TRC shRNA lentiviral library containing 80’000 lentiviral clones targeting 15’000 genes was purchased from Sigma-Aldrich. Cells (3,000 per well ...
-
bioRxiv - Molecular Biology 2021Quote: All lentivirus-based shRNA clones used for making the viral transduction particles were purchased from Sigma-Aldrich. pLKO.1-Puro vector targeting human PPARA or non-target vector as a control was used ...
-
bioRxiv - Microbiology 2021Quote: ... ICAM-1kd PLB985 cells were generated by lentiviral transduction with ICAM-1 specific shRNAs from Sigma (TRCN0000372478). EPCRkd PLB985 cells were generated by lentiviral transduction with EPCR specific shRNAs from Sigma (TRCN0000300553) ...
-
bioRxiv - Cancer Biology 2022Quote: Expression of either CAPN1 or CAPN2 was knocked down in U251N using shRNA purchased from Sigma-Aldrich (CAPN1 ...
-
bioRxiv - Cell Biology 2022Quote: shRNAs against APPL1 and EEA1 were selected from de Broad Institute GPP database and purchased from Sigma (MISSION TRC shRNAs purified plasmid DNA) ...
-
bioRxiv - Cancer Biology 2022Quote: pLKO.1-puro lentiviral vectors expressing shRNAs targeting HSP8A (shHSPA8_1: NM_006597.3-2040s21c1) and HSP90AA1 (NM_005348.x-1505s1c1) were purchased from Sigma-Aldrich. These vectors contain a puromycin antibiotic resistance gene for selection of transduced mammalian cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... we transduced MCF7 and HS5 cells with shRNA against CCDC88A (clone TRCN0000129915, Millipore Sigma, Burlington, MA, USA), preparing lentiviruses as described previously (87) ...
-
bioRxiv - Cancer Biology 2023Quote: An shRNA library targeting 284 pancreatic cancer related genes was generated using the pLKO vector backbone (Sigma). Each gene was targeted with 3-4 shRNA producing a library size of 1013 shRNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... As a control we used a shRNA against Luciferase (cat# SHC007, Sigma-Aldrich, Saint Louis, MO, USA). The following sequences were used as a shRNA target shRNA-Luciferase ...
-
bioRxiv - Cancer Biology 2023Quote: ... The LDHA shRNA vector (TRCN0000164922) was validated for 96% knockdown in HEK293T cells (Sigma, St. Louis, MO). Both vectors were packaged into lentiviral particles prior to transfection ...
-
bioRxiv - Molecular Biology 2023Quote: ... Lentiviral shRNA constructs in the pLKO.1-puro vector were purchased as glycerol stocks from Millipore Sigma. For shADAR1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... shRNAs that stably integrated into mouse cells were chosen through selection with 10 μg/ml puromycin (Sigma). For the generation of Nat10-overexpressing cells ...
-
bioRxiv - Cell Biology 2024Quote: Stable MMP9 knockdown cell lines were generated using two independent shRNA sequences (CCACAACATCACCTATTGGAT and CAGTTTCCATTCATCTTCCAA; Sigma Aldrich). The transduced cells were selected using puromycin (Catalogue number CMS8861 ...
-
bioRxiv - Biochemistry 2021Quote: ... These Wild Type or Mutant Type let-7a-5p plasmids were co□transfected into treated human chondrocytes cells along with NC mimics or KCNQ1OT1 mimic (Sigma□Aldrich; Merck KGaA) using Lipofectamine 6000 following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Sub-confluent T175 flasks of 293T cells (human embryonic kidney cell line) were transfected with the RBD-His tagged plasmid using X-tremeGENE 9 reagent (Millipore Sigma, Cat# 6365809001). The supernatant was collected six days post-transfection and filtered through 0.22μm PES membrane filters (Nalgene) ...