Labshake search
Citations for Millipore Sigma :
1 - 50 of 4287 citations for Human UFL1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: shRNAs plasmids were purified from the MISSION® shRNA Human Library (Sigma). Non-targeting control shRNA (shCo ...
-
C53 interacting with UFM1-protein ligase 1 regulates microtubule nucleation in response to ER stressbioRxiv - Cell Biology 2020Quote: ... UFL1 (Sigma-Aldrich), C53 (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2020Quote: HEK293T cells were transfected with pLKO.1 shRNA plasmid (Sigma, Mission human genome shRNA library) and packaging plasmids-delta 8.9 ...
-
bioRxiv - Systems Biology 2020Quote: ... shRNA plasmid against human GEF-H1 was obtained from Sigma (clone ID ...
-
bioRxiv - Cancer Biology 2022Quote: ... KDM6B targeting human shRNA plasmid was purchased from Sigma (TRCN0000236677). Scrambled vector sh-Control (sh-C ...
-
bioRxiv - Cell Biology 2021Quote: plasmids were from the MISSION Human shRNA library (Millipore SIGMA). The pLKO.1eGFP control vectors (EV ...
-
bioRxiv - Genetics 2020Quote: Lentiviruses carrying shRNA plasmids (MISSION shRNA, Sigma-Aldrich) for each DUX4 target gene ...
-
bioRxiv - Molecular Biology 2020Quote: Lentiviral pLKO.1-puro empty vector control plasmid and human TENT4A shRNA pLKO.1-puro plasmid (clone TRCN0000053036, target sequence CCAACAATCAGACCAGGTTTA) were obtained from Sigma (Mission shRNA library). Lentiviruses were produced in 293FT cells ...
-
bioRxiv - Cell Biology 2019Quote: ... were mixed with shRNA plasmid (Mission shRNA, Sigma-Aldrich) in Optimem medium (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: shRNA: MISSION shRNA plasmids (Sigma-Aldrich; see Table 1) at 2.5μg/μL were mixed with pCAG-myr-mClover or pCAG-myr-TdTomato plasmids at 2.5μg/μL and electroporated at E14.5 to target CPN ...
-
bioRxiv - Immunology 2020Quote: ... human CtIP-specific shRNA (Sigma, TRCN0000318738 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Mission shRNA plasmids (Sigma Aldrich) were transfected together with pMDLg/pRRE ...
-
bioRxiv - Cancer Biology 2022Quote: ... shRNA control plasmid (SHC002. Sigma) was used as non-targeting control ...
-
bioRxiv - Immunology 2020Quote: ... and human RNF20-specific shRNA (Sigma, TRCN0000033876 ...
-
bioRxiv - Neuroscience 2020Quote: ... shRNA plasmids were acquired from Sigma: Mouse Tor1b (TRCN0000106485) ...
-
bioRxiv - Microbiology 2023Quote: ... ShRNA plasmids were acquired from Sigma for EHD1 and MICAL-L1 ...
-
bioRxiv - Microbiology 2021Quote: TRC Lentiviral shRNA plasmids (pLKO.1) MISSION shRNA were obtained from Sigma- Aldrich (SHC002 ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids carrying an NBS1 shRNA (Open Biosystems) or a control shRNA (Sigma) in the pLKO background backbone were a kind gift from Cary A ...
-
bioRxiv - Biochemistry 2020Quote: ... The shRNA lentiviral plasmids (pLKO.1-puro) for human/mouse/rat frataxin were purchased from Sigma. The RefSeq used was NM-008044 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The lentivirus containing small hairpin RNA (shRNA) (Sigma, Mission Human Genome shRNA Library) against the target gene was inoculated in the presence of 8μg/ml polybrene (Sigma ...
-
bioRxiv - Immunology 2020Quote: ... NOSIP shRNA plasmids were obtained from Sigma (MISSION shRNA, cat. No. NM 015953). A cocktail of three different shRNA plasmids was used ...
-
bioRxiv - Genomics 2024Quote: Plasmid pLKO-puro shRNA clones (Mission shRNA) were purchased from Sigma (SHC016 (shCTRL); TRCN0000000993 (shMAP3K5) ...
-
bioRxiv - Genetics 2019Quote: ShRNA plasmids used were acquired from Sigma: Tor1b (TRCN0000106485) ...
-
bioRxiv - Cell Biology 2022Quote: ... Plasmids containing shRNA were purchased from Sigma in the pLKO.1 vector ...
-
bioRxiv - Cancer Biology 2023Quote: Plasmids used for shRNA interference (Sigma-Aldrich) were as follows ...
-
bioRxiv - Cancer Biology 2022Quote: Human HEK-293T cells transfected with either LacZ shRNA (control) or IKKα shRNAs (Sigma) along with their corresponding packaging plasmids were used to prepare lentiviruses from cell culture medium 48 h after transfection ...
-
bioRxiv - Cancer Biology 2022Quote: Cells were transduced with lentivirus encoding shRNA targeting against human SLC25A51 (Sigma, Mission shRNA). shRNA sequences used are ...
-
bioRxiv - Molecular Biology 2023Quote: ... A lentivirus plasmid vector containing an shRNA insert not targeting human and mouse genes (SHC002, Sigma-Aldrich) was used as a non-target control (shCTL).
-
bioRxiv - Immunology 2019Quote: ... TBK1 (SHCLND-NM_013254) or non-Target shRNA Control Plasmid DNA were all obtained from Sigma (MISSION shRNA Plasmid DNA). Briefly ...
-
bioRxiv - Immunology 2019Quote: ... TBK1 (SHCLND-NM_013254) or non-Target shRNA Control Plasmid DNA were all obtained from Sigma (MISSION shRNA Plasmid DNA). In brief ...
-
bioRxiv - Neuroscience 2019Quote: ... and pLKO plasmids containing shRNA against Rai1 untranslated region (Rai1-shRNA #1: Sigma, TRCN0000124984) or coding region (Rai1-shRNA #2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... GPX4 shRNA in cloned in PLKO.1-puro-shRNA plasmid were purchased from Sigma-(TRCN0000046249 ...
-
bioRxiv - Cancer Biology 2021Quote: ... ERK5 was silenced with human or mouse shRNAs purchased as pre-cloned in the pLKO.1-puro plasmid (MISSION® shRNA, Sigma-Aldrich, St Louis, MO, USA). Control shRNAs in the same plasmid were also purchased (Sigma) ...
-
bioRxiv - Cell Biology 2020Quote: ... or short hairpin RNA (shRNA) sequences encoded in pLKO.1 plasmid: Nontargeting control shRNA (shC, Sigma-Aldrich, Mission shRNA SHC002), GMAP210 shRNA (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2020Quote: ... shRNA plasmids (details below) were purchased from Sigma; the CRISPR/CAS9 plasmid ...
-
bioRxiv - Cancer Biology 2020Quote: ... Lentiviral shRNA plasmids were obtained from Sigma-Aldrich in the form of MISSION pLKO.1-puro vector ...
-
Splicing variation of BMP2K balances endocytosis, COPII trafficking and autophagy in erythroid cellsbioRxiv - Cell Biology 2020Quote: ... MISSION shRNA plasmids were obtained from Sigma-Aldrich. LentiCRISPRv2 vector was a gift from K ...
-
bioRxiv - Molecular Biology 2022Quote: ... Lentiviral Plin1 shRNA plasmid was purchased from Sigma. Lentivirus was first packaged in 293 FT cells using co-transfection with LV-MAX Lentiviral packaging mix (ThermoFisher ...
-
bioRxiv - Cancer Biology 2023Quote: ... All shRNA plasmids used were purchased from Sigma. Cells were transduced by incubation with 1:1 diluted lentivirus for 1-2 days and then selected with the antibiotic marker (puromycin or hyrgomycin ...
-
bioRxiv - Cancer Biology 2021Quote: ... LacZ shRNA (control) and 4 different DARPP-32 shRNAs cloned in pLKO.1 plasmids (Sigma) along with their corresponding packaging plasmids were transfected in human HEK-293T cells ...
-
bioRxiv - Cell Biology 2023Quote: MISSION lentiviral packaging plasmids and shRNA plasmids were purchased from Sigma-Aldrich. Generation of Lentiviral delivery vectors was performed according to manufacturer’s recommendation ...
-
bioRxiv - Immunology 2021Quote: shRNA clones were obtained from the whole RNAi human library for shRNA mediating silencing (Sigma, Aldrich) maintained at IISER ...
-
bioRxiv - Cell Biology 2020Quote: ... or shRNA directed against human IP6K1 (TRC0000013508, Sigma-Aldrich) were co-transfected with VSV-G and psPAX2 (a gift from Didier Trono ...
-
bioRxiv - Cell Biology 2021Quote: ... shRNAs against human CDCP1 (TRCN0000134829 and TRCN0000137203, Sigma-Aldrich) and MMP17 (TRCN0000049976 and TRCN0000049977 ...
-
bioRxiv - Cell Biology 2022Quote: Transfer plasmids with pre-designed shRNA against human Cdc42 mRNA were obtained from the Mission® TRC library (Sigma). Specifically ...
-
bioRxiv - Molecular Biology 2020Quote: Production of shRNA-expressing lentiviral particles was performed as described previously (12) using plasmids expressing shRNAs targeting MRE11 (Sigma mission shRNA TRCN000338391), NBS1 (Sigma mission shRNA TRCN0000288622 ...
-
bioRxiv - Cancer Biology 2022Quote: ... or negative control shRNA (TRC2 pLKO.5-puro Non-Target shRNA Control Plasmid DNA, SHC216, Sigma) were transfected to 60-70% confluent 293T cells grown on 6-well plates (1156D98 ...
-
bioRxiv - Neuroscience 2021Quote: The DcpS-specific shRNA plasmid was purchased from Millipore-Sigma (DcpS MISSION shRNA ...
-
bioRxiv - Cancer Biology 2020Quote: BMI1 shRNA plasmids were purchased from Sigma (pLKO.1). The catalog numbers are shBMI1-2 ...
-
bioRxiv - Immunology 2020Quote: Lentiviral plasmids encoding shRNAs were obtained from Sigma-Aldrich and all-in-one vectors carrying CTNNB1 sgRNA/Cas9 with GFP reporter were obtained from Applied Biological Materials ...