Labshake search
Citations for Millipore Sigma :
351 - 400 of 4532 citations for Human LACC1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... containing cGAS shRNA sequences (shcGAS #1, TRCN0000428336; shcGAS #2, TRCN0000149811) and non-target shRNA control vector (shScramble, SHC016) were purchased from Sigma.
-
bioRxiv - Immunology 2020Quote: ... The pLKO vectors either encoded two specific shRNAs against mouse Akt1 (Cat# TRCN0000304683) or a non-silencing control shRNA sequence (Cat# SHC002) (all from Sigma). Akt1 shRNA and control non-silencing shRNA viruses were intratracheally instilled in mice in a volume of 50 µl ...
-
bioRxiv - Neuroscience 2021Quote: ... HT22 cells were infected with lentivirus carrying the control scrambled-shRNA (5’-CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTTG-3’) or CB-specific shRNA (5’-CCGGGATTGGAGCTATCACCGGAAACTCGAGTTTCCGGTGATAGCTCCAATCTTTTTG-3’) with polybrene (Sigma) for two days ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µg of lentiviral expression construct shRNA (pLKO.1 Mission shRNA DNA clone, Sigma-Aldrich Inc., St. Louis, MO, USA) control ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLKO.1 plasmids containing shRNAs targeting KCNN4 and control non-target sequences (Supplementary Table 1) were obtained from Sigma-Aldrich (St Louis, USA) and transfected into HEK293T cells with a packaging mix that contains a pCMV-dR8.91 (Delta 8.9 ...
-
bioRxiv - Cell Biology 2020Quote: The ATF3 shRNA constructs were purchased from Sigma. The pSIN-3×flag-ATF3 vector was derived from pSin-EF2-Nanog-Pur (#16578 ...
-
bioRxiv - Cell Biology 2020Quote: ... The non-mammalian targeting shRNA (Cat # SHC002V, Sigma) was used as a negative control ...
-
bioRxiv - Microbiology 2022Quote: ... and GIGYF2 shRNA#3 (shGIGYF2#3) (Sigma, TRCN0000135088).
-
bioRxiv - Cancer Biology 2019Quote: ... JUN and control shRNA were purchased from Sigma (their catalog numbers are listed in Supplementary Table S1) ...
-
bioRxiv - Cancer Biology 2019Quote: TCF4 MISSION shRNA was purchased from Sigma-Aldrich (St ...
-
The genetic status of IDH1/2 and EGFR dictates the vascular landscape and the progression of gliomasbioRxiv - Cancer Biology 2020Quote: ... Lentiviral vector to express shRNAs were: shCD248 (Sigma #SHCLNG-NM_020404 ...
-
bioRxiv - Cell Biology 2021Quote: ... pLKO.1-puro non-target shRNA (Sigma-Aldrich) was used to produce the shCTL clone.
-
bioRxiv - Cancer Biology 2022Quote: PRMT5 shRNAs in pLKOpuro vector were from Sigma sh1 (H3 ...
-
bioRxiv - Molecular Biology 2022Quote: ... All constructs encoding shRNAs were purchased from Sigma.
-
bioRxiv - Biochemistry 2022Quote: ... the pLKO.1 TRC1 shRNA library (SIGMA-ALDRICH) was used ...
-
bioRxiv - Cancer Biology 2022Quote: ... and IRF3 shRNA-2 (Sigma-Aldrich, cat. TRCN0000005923). DNA for experiments was obtained using endotoxin-free plasmid purification kits (NucleoBond Xtra Midi EF ...
-
bioRxiv - Cancer Biology 2022Quote: ... RELA/p65 shRNA-1 (Sigma-Aldrich, cat. TRCN0000014687); RELA/p65 shRNA-2 (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2022Quote: ... RELA/p65 shRNA-2 (Sigma-Aldrich, cat. TRCN0000014684); IRF3 shRNA-1 (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... All other shRNA constructs were acquired from Sigma and shRNA sequence used ...
-
bioRxiv - Neuroscience 2022Quote: ... and 4EBP1 shRNA constructs were purchased from Sigma: human TIMMDC1 (TRCN0000154913) ...
-
bioRxiv - Neuroscience 2019Quote: ... or coding region (Rai1-shRNA #2: Sigma, TRCN0000328334) or scramble shRNA (Sigma ...
-
bioRxiv - Cell Biology 2019Quote: ... lentiviral shRNAs with 6 μg/ml polybrene (Sigma) was added dropwise to the media ...
-
bioRxiv - Physiology 2023Quote: ... shRNA lentiviral transduction particles were purchased from Millipore-Sigma to deliver and stably express shRNAs in MEFs ...
-
bioRxiv - Neuroscience 2024Quote: ... encoding an shRNA targeting TARDBP sequence (TRCN0000016038, SIGMA). Lentiviral particles were produced in the HEK293T cell line using psPAX2 (12260 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Mission shRNA clones were purchased from Sigma-Aldrich. The sequences of each shRNA are presented in Table S2 ...
-
bioRxiv - Cancer Biology 2023Quote: BMP6 shRNA (TRCN0000432077) was purchased from Sigma-Aldrich. Stable knockdown BMP6 JK43-P and JK43-M cells were selected with 5ug/ml puromycin.
-
bioRxiv - Cancer Biology 2023Quote: ... shBRD4-L (#TRCN0000021424, Mission shRNA, Sigma-Aldrich Inc.) or shBRD4-S (#TRCN0000349782 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The other shRNAs were purchased from Sigma-Aldrich, with shRNAs against ZNF587B/814 and ZNF586 targeting the following sequences ...
-
LRBA balances antigen presentation and T-cell responses via autophagy by binding to PIK3R4 and FYCO1bioRxiv - Immunology 2024Quote: ... containing the shRNA sequence: CCGGGCAGAAGATATTCACAGACATCTCGAGATGTCTGTGAATATCTT-CTGCTTTTTTG (TRCN0000148136, SIGMA) according to the manufactureŕs instructions (fig ...
-
bioRxiv - Cancer Biology 2024Quote: ... and scrambled shRNAs were obtained from Sigma Aldrich. shRNA plasmids were packaged using the third-generation lenti-vector system (pMDLg/pRRE ...
-
bioRxiv - Cell Biology 2024Quote: Two shRNA sequences were purchased from Millipore Sigma and cloned into the pLKO.1 lentiviral vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... two CSNK1D targeting shRNA constructs were selected from the Mission TRC shRNA library (TRCN0000023769, named shCSNK1D#1; TRCN0000361946, named shCSNK1D#2; Sigma-Aldrich); non-targeting scrambled shRNA served as control (shc002 ...
-
bioRxiv - Cell Biology 2021Quote: ... validated lentiviral constructs (pLKO.1) expressing Mission shRNA targeting the following region 5’-GCTAGATTTACTAATGCCA-3’ in CPAP or scrambled shRNA were purchased from Sigma-Aldrich. For generation of stable cells ...
-
bioRxiv - Molecular Biology 2022Quote: shRNA pLKO.1 plasmids expressing non-targeting control shRNA (NTC: SHC002) or anti- DDX39B shRNAs (Sh3: TRCN0000286976; and Sh5: TRCN0000294383) were purchased from Millipore Sigma. The construct pLCE-DDX39B was generated by cloning the coding sequence of DDX39B into the pLCE vector ...
-
bioRxiv - Cancer Biology 2019Quote: ... The pLenti pLKO-non-target shRNA control vector (SHC002) and two different pLenti-mouse shRNA vectors for FYN were selected from Sigma Aldrich MISSION® shRNA Vectors ...
-
bioRxiv - Neuroscience 2022Quote: ... We purchased a MISSION shRNA vector library encoding the microRNA-adapted shRNA targeting mouse Inka1 (Sigma-Aldrich, St. Louis, MO, USA). Among five shRNA clones (TRCN0000269004 ...
-
bioRxiv - Cell Biology 2022Quote: ECs isolated from a single umbilical cord were split in two and transduced before the first passage with lentivirus encoding control or COL4A1 targeting shRNA (Sigma-Mission shRNA) (Bignon et al. ...
-
bioRxiv - Molecular Biology 2024Quote: ... cell lines were generated from parental mountain hare (LT1) and brown hare (LE3) cell lines by lentiviral transduction of shRNA (TRCN0000028617 and TRCN0000028579 MISSION® shRNAs, Sigma-Aldrich) followed by puromycin-resistant marker selection.
-
bioRxiv - Cancer Biology 2023Quote: ... we employed shRNA technology using the pLKO.1 (constitutive) or pLKO-3xLacO (inducible by IPTG) vector systems from MISSION® shRNA (Sigma Aldrich). In the constitutive system ...
-
bioRxiv - Physiology 2024Quote: AC16 cells were transduced with GCN5L1 shRNA and ORF lentiviral particles at a multiplicity of infection (MOI) of 10 with scrambled control or GCN5L1 shRNA (Sigma-Aldrich, USA) and Control and GCN5L1 ORF lentiviral particles (Origene ...
-
bioRxiv - Neuroscience 2024Quote: ... isyn cells were transduced with a lentiviral Rab27b-targeted shRNA (5′-CCCAAATTCATCACTACAGTA-3′) to knock down Rab27b or with a lentiviral nontarget (nt) shRNA (Sigma-Aldrich SHC016), as a control as previously described [32].
-
bioRxiv - Cancer Biology 2021Quote: ... or shMCU (#SHCLNG-NM_138357 Mission shRNA, Sigma-Aldrich Inc.). 16hr post-transfection ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were transfected with shRNAs purchased from Sigma-Aldrich (shPTPRH-373 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lentiviral shRNA constructs for PPARGC1A were purchased from Sigma. Lentiviral particles were generated by co-transfecting HEK293T cells with packaging plasmids using the calcium phosphate method ...
-
bioRxiv - Cell Biology 2020Quote: ... The lentivirus plasmid vector pLKO 1-YFP was obtained from Sigma’s validated genome-wide TRC shRNA libraries (Sigma-Aldrich) and was further changed to eGFP in-house.
-
bioRxiv - Cancer Biology 2019Quote: ... NRF2 targeting pLKO shRNA expression were obtained from Sigma (shNRF2#1 ...
-
bioRxiv - Cancer Biology 2019Quote: ... and nontargeting shRNA control were obtained from Sigma Aldrich in the pLKO vector ...
-
bioRxiv - Cancer Biology 2019Quote: ... The shRNA control was purchased from Sigma-Aldrich (#SHC002). pLX317-NRF2 and pLX317-NRF2T80K were obtained from Dr ...
-
bioRxiv - Cell Biology 2019Quote: ... Control and Vav1 shRNA constructs were obtained from Sigma. The HIF-1α construct was obtained from Addgene (Watertown ...
-
bioRxiv - Molecular Biology 2020Quote: shRNAs and siRNA duplexes were obtained from Sigma-Aldrich, Dharmacon or Qiagen (Table 8 ...