Labshake search
Citations for Millipore Sigma :
101 - 150 of 4285 citations for Human GSDMC shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... and Synt16 shRNA (Sigma-Aldrich, Mission shRNA, TRCN0000161930). Lentivirus were recovered in supernatant after 2 days and concentrated ...
-
bioRxiv - Neuroscience 2023Quote: ... The shRNA universal negative control (Sigma, Control shRNA) was used as a non-targeting control (Suppl ...
-
bioRxiv - Neuroscience 2024Quote: ... The shRNA universal negative control (Sigma, Control shRNA) was used as a non-targeting control (Suppl ...
-
bioRxiv - Cancer Biology 2022Quote: ... 50,000 human ECs (RBPJ knock-out or shRNA for CXCL2 (pLKO.1; Sigma Aldrich) and respective controls ...
-
bioRxiv - Immunology 2020Quote: ... were obtained from the whole RNAi human library for shRNA mediating silencing (Sigma, Aldrich) maintained at IISER ...
-
bioRxiv - Immunology 2020Quote: ... were obtained from the whole RNAi human library for shRNA mediating silencing (Sigma, Aldrich) maintained at IISER ...
-
bioRxiv - Cancer Biology 2024Quote: ... and two distinct shRNAs targeting human NINJ1 RNA were acquired from Sigma (TRCN0000063769, TRCN0000289088). For the overexpression of both NINJ1 and xCT ...
-
bioRxiv - Cell Biology 2022Quote: ... shRNA clones were purchased from lentiviral vector-based shRNA libraries (MISSION shRNA library, Sigma-Aldrich). Lentivirus packaging was performed as previous reported (89) ...
-
bioRxiv - Cell Biology 2021Quote: ... For Syntenin-1 target pLKO.1 plasmids with shRNA sequences were obtained from Sigma mission library (KD1 ...
-
bioRxiv - Cell Biology 2022Quote: ... a plasmid (pLKO.1-puro backbone) containing shRNA sequence (CCGGGATGAAGAATATCGTCCACAACTCGAGTTGTGGACGATATTCTTCATCTTTTTG) was purchased from Sigma (Mission shRNA ...
-
bioRxiv - Cancer Biology 2020Quote: ... The non-silencing shCTR (mission control shRNA plasmid DNA) was purchased from Sigma aldrich. Transfection medium was replaced 24 h later with new complete DMEM and 48 h after transfection the lentiviral containing medium was collected ...
-
bioRxiv - Cancer Biology 2023Quote: ... the DNA mix (1.34 μg shRNA-plasmid DNA (TRCN0000296954; TRCN0000291711, Sigma-Aldrich, Taufkirchen, Germany) or pLV[Exp]-EGFP:T2A:Bsd-CMV>ORF_Stuffer (VectorBuilder ...
-
bioRxiv - Genomics 2022Quote: Non-targeting shRNA construct was obtained from Sigma (SHC202; pLKO.5-puro Control Plasmid). Zfp281 targeting shRNA gene was obtained from Sigma (Clone ID ...
-
bioRxiv - Cell Biology 2023Quote: ... shRNA plasmid against mouse HK1 and empty vector control were purchased from Sigma-Aldrich MISSION.
-
bioRxiv - Cell Biology 2023Quote: ... RBL2 and non-targeting control shRNA lentiviral transfer plasmids were either purchased from Sigma or generated by cloning sequences into pSicoR-Ef1a-mCh-Puro-Puro (#31847;Addgene ...
-
bioRxiv - Molecular Biology 2021Quote: Pre-designed shRNA sequences (MISSION® shRNA library (Sigma); Table 2 ...
-
bioRxiv - Neuroscience 2021Quote: ... 10µg of shRNA vector (Mission® shRNA, Sigma Aldrich), 2.9µg pRSV-REV ...
-
bioRxiv - Cancer Biology 2021Quote: ... were subjected to lentiviral transduction with either the Tg2-targeting MISSION shRNA plasmid (SHCLND-NM_004613: TRCN0000272816) (MDA- (scr)) or the MISSION scr.1-puro scrambled control plasmid DNA (SHC001; Millipore Sigma) (MDA- (shTg2)) ...
-
bioRxiv - Cancer Biology 2022Quote: ... As a negative control a plasmid expressing the scramble sequence (MISSION pLKO.1-puro shRNA Control Plasmid DNA) was purchased from Sigma- Aldrich.
-
bioRxiv - Developmental Biology 2022Quote: Lentiviral particles encoding Flag-tagged human PDHA1 or shRNAs targeting mouse Pdha1 (TRCN0000041914/TRCN0000041914 (Sigma)) were produced in 293T packaging cells by transient transfection using Jet-PEI reagent (Ozyme) ...
-
bioRxiv - Cancer Biology 2024Quote: ... shRNA constructs in a pLKO.1 vector targeting human CHMP5 were purchased from Sigma Aldrich along with 2 control non-targeting shRNAs ...
-
bioRxiv - Cell Biology 2022Quote: ... the same pLKO-based plasmid expressing a non-target shRNA was purchased from Sigma-Aldrich and used ...
-
bioRxiv - Cell Biology 2019Quote: shRNA expression plasmids (in pLKO.1 or pLKO1.5) were obtained from Sigma (Supplemental Table 4). pLKO.3G (Addgene ...
-
bioRxiv - Physiology 2019Quote: ... Plasmids encoding shRNA for mouse LPCAT3 (shLPCAT3: TRCN0000121437) were obtained from Sigma (St. Louis, MO). Packaging vector psPAX2 (ID #12260) ...
-
bioRxiv - Cell Biology 2019Quote: ... the pLKO.1-puro non-mammalian shRNA Control Plasmid DNA was used (SHC002, Sigma-Aldrich). Two million Ecadherin-GFP MDCK cells were electroporated (Neon Transfection System Invitrogen ...
-
bioRxiv - Cancer Biology 2019Quote: ... Mouse small hairpin RNAs (shRNAs) for Cep55 (pLKO plasmids, (Sigma Aldrich®, St Louis, USA)) clones were established using lentiviral packaging using PEI (Poly -ethyleneimine ...
-
bioRxiv - Immunology 2022Quote: ... HeLa cells were transfected using Lipofectamine2000 and 200 ng of MISSION shRNA plasmids (Sigma-Aldrich, TRCN0000006342 ...
-
bioRxiv - Microbiology 2022Quote: ... lentiviral plasmids containing COL6A1 or COL6A3 short hairpin RNA (shRNA) (Sigma-Aldrich, TRCN0000116959 and TRCN0000003622), or MISSION pLKO.1-puro Non-Mammalian shRNA Control (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2022Quote: ... Elavl1 shRNAs were adapted from the MISSION shRNA library (Sigma). Annealed oligos were digested with FastDigest XhoI/EcoRI (ThermoFisher ...
-
bioRxiv - Cancer Biology 2020Quote: ... shRNAs were selected among pre-validated Mission pLKO1-shRNA (Sigma) and the corresponding U6-shRNA-cPPT cassettes were subcloned into PB-empty vector (24) ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA constructs targeting BRD2 were purchased from Sigma (Mission shRNA).
-
bioRxiv - Molecular Biology 2022Quote: We co-transfected HEK293T cells with overexpression plasmids or shRNA viral plasmids with lentiviral packaging vectors using X-tremeGENE 9 (Sigma-Aldrich), and we collected viruses at 48 h post-transfection ...
-
bioRxiv - Cancer Biology 2019Quote: ... Scrambled shRNA (Sigma) was used as negative control ...
-
bioRxiv - Cancer Biology 2020Quote: Mission shRNAs (Sigma) were used for RNA interference ...
-
bioRxiv - Cancer Biology 2020Quote: ... shRNA oligos (Sigma) were annealed by temperature ramp from 100°C to 25°C and cloned into pLKO.1 vector between AgeI and EcoRI sites ...
-
bioRxiv - Neuroscience 2023Quote: ... Dusp6 shRNA (Sigma, mission shRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... the sequence of the shRNA targeting 3UTR of human NRF2 gene was obtained from Sigma Aldrich (TRCN0000007555 ...
-
bioRxiv - Microbiology 2022Quote: ... The following shRNAs were used: Non-Targeting Control shRNA (Sigma, SHC002), EIF4E2 shRNA#1 (sh4EHP#1 ...
-
bioRxiv - Pathology 2023Quote: Lentiviruses expressing inducible shRNA (Sigma-Aldrich, MISSION™ shRNA inducible vectors) were used to silence HDAC and ATG5 ...
-
bioRxiv - Neuroscience 2020Quote: ... SH-SY5Y cells were transfected with pLKO.1 vector (MISSION ® shRNA plasmid DNA, Sigma-Aldrich) containing a hairpin sequence of FXN (TRCN0000006138 ...
-
bioRxiv - Cancer Biology 2021Quote: ... we transduced LXF-289 (A3A) cells with the non-mammalian shRNA Control Plasmid DNA shC002 (Sigma).
-
bioRxiv - Neuroscience 2021Quote: ... and the shRNA to knock-down plasmid for mouse eIF4EBP1 was obtained from Sigma Aldrich (TRCN0000335381).
-
bioRxiv - Genomics 2019Quote: The MISSION pLKO.1-puro human TDP-43 (TRCN0000016038) and control shRNAs (Sigma Aldrich SHC007 and SHC016) were used to produce lentivirus ...
-
bioRxiv - Immunology 2021Quote: Lentivirus based knockdown of human ATG16L1 (5’-ACTGTAGCTTTGCCGTGAATG-3’) was performed using MISSION shRNA constructs (Sigma-Aldrich) and psPAX2 packaging system ...
-
bioRxiv - Immunology 2020Quote: ... MISSION shRNA Lentiviral Transduction Particles against human CLPP (TRCN0000291174) or eGFP (RHS4459) were purchased from Sigma-Aldrich and Horizon Discovery respectively ...
-
bioRxiv - Biophysics 2021Quote: ... IRSp53 60950 shRNA and control Non-Targeting shRNA were purchased from Sigma Mission for viral transfection and stable cell line creation ...
-
bioRxiv - Cancer Biology 2024Quote: ... Two different short hairpin (shRNA, from Sigma-Aldrich shRNA library; Table 1), scrambled shRNA control (Addgene plasmid #1864) ...
-
bioRxiv - Neuroscience 2024Quote: ... or one of the RCOR3-shRNA-mCherry-BSD plasmids or the TetO-SOX9-NFIB-mPlum-Puro plasmid using Polyethyleneimine (Sigma-Aldrich, USA, #408727). DNA is added in a ratio of 4:2:1:1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The shRNAs constructs (Sigma) used in this study are as follows ...
-
bioRxiv - Molecular Biology 2019Quote: ... The shRNAs constructs (Sigma) used in this study are as follows ...