Labshake search
Citations for Millipore Sigma :
401 - 450 of 4285 citations for Human DOK4 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... we used the MISSION® Lentiviral shRNA (Sigma Aldrich/Merck ...
-
bioRxiv - Cancer Biology 2024Quote: ... Short-hairpin RNA (shRNA) constructs were obtained from Sigma (TRCN0000303918 ...
-
bioRxiv - Cancer Biology 2024Quote: ... CTNNB1 and CTNNA1 shRNA vectors were from Sigma-Aldrich.
-
bioRxiv - Cancer Biology 2022Quote: ... MDA-468 cells were also modified with lentiviral vectors to stably express shRNA to LMNA and (MISSION anti-LMNA shRNA, available through Sigma, TRCN0000061835, NM_170707.1-752s1c1) or control non-target MISSION control shRNA (available through Sigma) ...
-
Phospholipase C β4 promotes RANKL-dependent osteoclastogenesis by interacting with MKK3 and p38 MAPKbioRxiv - Cell Biology 2024Quote: The lentiviral constructs containing PLCβ4 small hairpin RNA (shRNA) or a non-specific shRNA control (Con-sh) were obtained from Sigma-Aldrich (St. Louis, MO, USA). Lentiviral particles were generated by transfecting 293T cells with the expression constructs ...
-
bioRxiv - Microbiology 2020Quote: ... Lentivirus expressing shRNAs targeting mouse Irf7 transcripts (Irf7 shRNA1, Sigma TRCN0000077292 and Irf7 shRNA2 ...
-
bioRxiv - Cell Biology 2020Quote: ... and target sequences were based Mission shRNA database (Sigma-Aldrich). RNAi target sequences used in this research include:
-
bioRxiv - Neuroscience 2019Quote: ... the VDAC1 shRNA sequence 3 ACCAGGTATCAAACTGACGTTCT (Sigma-Aldrich, Ref. #TRCN0000012392) or the shRNA control (dsRed2 ...
-
bioRxiv - Physiology 2019Quote: ... pLKO.1 Sirt4 shRNA (TRC0000018948) was purchased from Sigma Aldrich. SIRT4 was cloned into pAdtrack CMV plasmid ...
-
bioRxiv - Neuroscience 2021Quote: ... we used pLKO.1-puro Mission shRNA vectors (Sigma-Aldrich). Target sequences are provided in Table S7 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 3 µg pLKO.1-shARID1A (MISSION shRNA (Sigma-Aldrich), (TRCN0000059090 or TRCN0000059089 ...
-
bioRxiv - Cancer Biology 2020Quote: ... MISSION shRNA constructs (TRCN0000236186 and TRCN0000236187) were purchased from Sigma and lentiviral partilces were generated in HEK293T cells by contransfecting shRNA plasmid construct with pMD2.G (Addgene#12259 ...
-
bioRxiv - Cancer Biology 2021Quote: ... were transduced with ready-made Mission shRNA lentiviral particles (Sigma) expressing four different LBH-specific shRNAs (TRCN0000107525-shLBH#1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and non-targeting shRNA control were obtained from Sigma-Aldrich in the pLKO vector and were prepared as previously described 15 ...
-
bioRxiv - Cancer Biology 2022Quote: ... or control non-target MISSION control shRNA (available through Sigma). MDA-231 and BT-549 cells were modified with NLS-RFP (pCDH-CMV-3xNLS-TagRFP-T-EF1-blastiSBT-549 [30] ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were infected with MISSION® shRNA lentiviruses (Sigma-Aldrich) designed for the human PRKCA gene (TRCN0000196730 ...
-
bioRxiv - Cancer Biology 2022Quote: shRNA targeting murine Map3k7 was purchased from Sigma-Aldrich (TRCN0000022563). A pLKO.1-puro Non-Target shRNA was used as control ...
-
bioRxiv - Cancer Biology 2020Quote: Four different mission shRNAs from the TRC1 library (Sigma-Aldrich, TRCN0000019174 ...
-
bioRxiv - Microbiology 2022Quote: NOD2 MISSION shRNA Lentiviral Transduction Particles from Sigma Aldrich (TRCN0000066813) were used to stably down-regulate NOD2 in J774 macrophage ...
-
bioRxiv - Cancer Biology 2022Quote: ... pCMV-VSV-G and shRNA-encoding lentiviral vectors (Sigma-Aldrich) into HEK293T cells with Lipofectamine 2000 Transfection Reagent (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: ... cDNA and shRNA expression were induced by Doxycycline (Sigma, D9891) at concentrations ranging from 0.1 to 1.0 μg/mL ...
-
bioRxiv - Cancer Biology 2021Quote: Lentiviral constructs expressing shRNAs directed against SLFN11 (Sigma TRCN, TRCN0000152057) or a non-targeting control shRNA (TRCN0000231489 ...
-
bioRxiv - Neuroscience 2021Quote: ... Lentiviral constructs expressing shRNA targeting rat IP3R1 (TRCN0000321161; Sigma-Aldrich) and TRPM2 (TRCN0000068488 Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... The shRNA-containing lentiviral vectors were purchased from Sigma Aldrich.
-
bioRxiv - Microbiology 2022Quote: ... shRNA is in TRC2-pLKO-puro vector (SHC201 Sigma-Aldrich) background with puromycin as a mammalian selection marker ...
-
bioRxiv - Molecular Biology 2022Quote: Non-target scrambled shRNA (SHC002) was purchased from Sigma Aldrich. shRNA to human raptor (plasmid#1857 ...
-
bioRxiv - Cancer Biology 2022Quote: MLL1 was depleted using two separate shRNA constructs (Millipore Sigma):
-
bioRxiv - Neuroscience 2022Quote: ... and shRNAs targeting Mmp24 and Pcdhαc2 were obtained from Sigma (Mmp24 shRNA ...
-
bioRxiv - Genomics 2022Quote: We purchased lentiviral shRNA-expressing constructs targeting Twist2 (Millipore Sigma clone IDs TRCN0000086084 ...
-
bioRxiv - Cell Biology 2023Quote: ... The knockdown efficiencies of shRNAs were provided by Sigma-Aldrich using quantitative PCR ...
-
bioRxiv - Cell Biology 2023Quote: ... MISSION pLKO.1 scrambled non-target shRNA SHC002 (Millipore Sigma) was used as a control for SNX17 knockdown constructs ...
-
bioRxiv - Biochemistry 2023Quote: MISSION TRC1.5 pLKO.1-puro Non-Mammalian shRNA Control (Sigma) was used as a control shRNA.
-
bioRxiv - Developmental Biology 2023Quote: ... The Mouse Ulk4 shRNA lentiviral vector was purchased from Sigma (TRCN0000328268 for Ulk4 knockdown in NIH3T3 cells and MEFs;TRCN0000002203 for Ulk4 knockdown in HEK293 cells) ...
-
bioRxiv - Biochemistry 2023Quote: ... or the pLKO.1-shRNA vector (Sigma Mission TRCN0000001418; ‘shDDR2’) using LipofectamineTM 2000 reagent (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... pLKO.1 (Mission shRNA library from Sigma-Aldrich, see below), and the packaging vectors ...
-
bioRxiv - Neuroscience 2024Quote: ... Lentiviruses expressing shGAN and shSCR have been described previously and were obtained from SIGMA MISSION shRNA systems: shGAN (MISSION® vector TRC # TRCN0000251146, Sigma) and shSCR (#SHC002 ...
-
bioRxiv - Neuroscience 2024Quote: ... TDP43-specific shRNA lentiviral clone (clone ID TRCN000016038, Sigma Aldrich) or SHC001 (shRNA Empty Vector Control Plasmid DNA) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and E-cad shRNA (TRCN0000237841, target sequence; AGATTGCACCGGTCGACAAAG, Millipore Sigma). Lentiviral supernatant was prepared by co-transfecting HEK-293T cells with lentivirus packaging plasmids ...
-
bioRxiv - Immunology 2019Quote: shRNA’s were acquired from the Mission library (Sigma, Zwijndrecht, the Netherlands) and were kindly provided by (dept ...
-
bioRxiv - Neuroscience 2020Quote: ... The following lentiviruses were used for transduction: Mission shRNA vectors (Sigma) shNT (Non-Mammalian shRNA Control ...
-
bioRxiv - Cancer Biology 2020Quote: Validated siRNAs and lentiviral constructs expressing shRNAs were purchased from Sigma. Constructs for CRISPR/Cas9-mediated gene knockout (Cas9 and guide RNAs ...
-
bioRxiv - Cell Biology 2021Quote: ... FOXO3A (TRNC0000010335, only clone validated by Sigma MISSION shRNAs, to date) and control (SHC002) ...
-
bioRxiv - Cancer Biology 2022Quote: Suppression of ABL1 was achieved using lentivirus-based shRNAs (Sigma Aldrich). Briefly ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: shRNAs targeting ABCG2 were obtained from Sigma-Aldrich (product# SHCLNG-NM_004827). Viral supernatants were prepared by transfecting 293T cells with GFP- or ABCG-targeting shRNAs encoded in pLKO.1 vectors using X-tremeGENE 360 transfection reagent (Roche ...
-
bioRxiv - Cancer Biology 2022Quote: ... The vectors encoding two different shRNAs targeting ERK5 were from Sigma (TRCN0000010262/pLKO.1 ...
-
bioRxiv - Neuroscience 2020Quote: ... A non-targeting shRNA (# SHC202) was also purchased from Sigma-Aldrich.
-
bioRxiv - Cell Biology 2020Quote: ... MDN1 and mouse Prmt1 were the validated MISSION shRNAs (Sigma-Aldrich). The shRNAs were TRCN0000290479 (human PRMT1) ...
-
bioRxiv - Cell Biology 2021Quote: ... Control and shRNA lentiviruses were purchased from Sigma-Aldrich (Table S3). Viral particles were added at a multiplicity of infection of 1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... controls pLKO (SHC001, no insert) and non-mammalian shRNA (Sigma; SCH002) in 293T cells using the third-generation lentiviral packaging system (10,11) ...
-
bioRxiv - Cancer Biology 2021Quote: shRNAs targeting the genes of interest were purchased from Sigma-Aldrich, including shRNAs targeting S100A11 (TRCN0000289926) ...