Labshake search
Citations for Millipore Sigma :
101 - 150 of 10000+ citations for Human Adrenomedullin 2 ADM2 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2021Quote: Plasma FGF21 (pg/ml) was measured using a human FGF21 ELISA kit (Millipore, Billerica, MA). In Experiment 2 ...
-
Preferred endocytosis of amyloid precursor protein from cholesterol-enriched lipid raft microdomainsbioRxiv - Neuroscience 2020Quote: ... Aβ42 levels were measured using a High Sensitivity Human Amyloid β42 ELISA Kit (Millipore, #EZHS42).
-
bioRxiv - Immunology 2022Quote: ... containing 2% (vol/vol) of heat inactivated (HI, for 1h at 56°C) human AB serum (hABS) (Sigma, #H3667). After extensive washings with DPBS (Gibco ...
-
bioRxiv - Cancer Biology 2019Quote: The AsPC-1 and Capan-2 human PC cell lines were obtained from Sigma-Aldrich (St. Louis, MO, USA) and Thermo Fisher (Waltham ...
-
Dual signaling via interferon and DNA damage response elicits entrapment by giant PML nuclear bodiesbioRxiv - Microbiology 2021Quote: ... an additional blocking step was performed by incubating cells with 2 mg/ml γ-globulins from human blood (Sigma) for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... 500 μg/mL rice-derived recombinant human albumin and 213 μg/mL L-ascorbic acid 2-phosphate (Sigma-Aldrich). After 24 hours of CHIR99021 stimulation ...
-
bioRxiv - Neuroscience 2019Quote: ... pH = 7.6) containing 0.01% Triton X-100 (TBS-T) and then blocked with 2% human serum albumin (HSA; Sigma-Aldrich) and 10% NGS in TBS-T for 30 min ...
-
bioRxiv - Immunology 2021Quote: ... The albumin analyte was selected and measured using MILLIPLEX MAP Human Kidney Injury Magnetic Bead Panel 2 (Millipore Sigma) following manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: Human serum albumin (fraction V) 98% and 5,5’-dithiobis-2-nitrobenzoic acid (DTNB) were purchased from Sigma Aldrich (USA) and used without any prior purification ...
-
bioRxiv - Biochemistry 2023Quote: ... Mouse primary cortical cultures were then treated with 0.5 μg/ml human recombinant tissue inhibitor of metalloproteinase-2 (TIMP2, Sigma) for one biological replicate or 10 μM BB94 for two biological replicates ...
-
bioRxiv - Immunology 2024Quote: ... which after solidification were overlayed by basal medium containing Advanced DMEM/F12 + 1:100 Glutamax + 10 mM HEPES + 1.25 mM N-AcetylCystein + 1:50 B-27 Supplement + 1:100 N-2 Supplement + 50 ng/ml human EGF + 1:500 Primocin + 0.002% Heparin (Sigma), supplemented with additional factors as described in the main text ...
-
Molecular basis of proteolytic cleavage regulation by the extracellular matrix receptor dystroglycanbioRxiv - Biochemistry 2024Quote: Recombinant human MMP-2 (R&D) and MMP-9 (R&D) were activated using p-aminophenylmercuric acetate (APMA, Sigma) in MMP assay buffer (50 mM Tris (Fisher) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... or human liver microsomes (HLMs) (male human pooled, Sigma-Aldrich), respectively ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human haemoglobin (Sigma) was used for creation of standard curve.
-
bioRxiv - Microbiology 2021Quote: ... human insulin (Sigma), 10’000 units/ml of penicillin and 10’000 µg/ml streptomycin (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... human HDL (Millipore), human LDLs (Millipore ...
-
bioRxiv - Microbiology 2021Quote: ... human LDLs (Millipore) or an in vitro reconstituted NS1-HDL mix were analyzed by size exclusion chromatography on a Superdex 200 10/300 column (GE healthcare) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Human hemoglobin (Sigma) was dissolved in PBS to 10 mg/mL or 1 mg/mL ...
-
bioRxiv - Microbiology 2023Quote: ... Human DPP4 (Sigma) was used as a control in PBS at 50 ng/μL (0.585 μM) ...
-
bioRxiv - Cell Biology 2020Quote: Caco-2 (human epithelial colorectal adenocarcinoma cell line) cells were purchased from ATCC and cultured in DMEM high glucose media (Sigma). The cells were trypsinized using 0.25% trypsin-EDTA and resuspended in the fresh media ...
-
bioRxiv - Immunology 2021Quote: ... the following components were added: 2 mM L-Glutamine (Fisher), 10% heat-inactivated (56°C, 60 min) human AB serum (Sigma), 12.5 mM HEPES (Fisher) ...
-
bioRxiv - Immunology 2020Quote: ... from 1:50 to 1:51200 in PBS containing 2% skimmed milk were added followed by ALP-conjugated anti-human IgG (A9544; Sigma) at 1:10,000 dilution ...
-
bioRxiv - Bioengineering 2021Quote: ... and 1,500 mg/L sodium bicarbonate (ATCC) supplemented with 2 ng/ml recombinant human Granulocyte-Macrophage Colony-Stimulating Factor (Sigma-Aldrich) and 10 % fetal bovine serum ...
-
bioRxiv - Microbiology 2019Quote: ... the slides were incubated for 2 hours at room temperature with 1 µg/mL Cy3-conjugated goat anti-human IgG (H+L) (Sigma) and washed again ...
-
bioRxiv - Cancer Biology 2020Quote: ... Concentrations of 29 cytokines/chemokines were measured in 2-4 biological replicates using MILLIPLEX Map Human Cytokine/Chemokine Magnetic Bead Panel (HCYTMAG-60K-PX29, #Millipore) according to manufacturer’s protocol.
-
bioRxiv - Microbiology 2021Quote: ... Samples were then diluted 1:2 in serum matrix for analysis with Milliplex Non-Human Primate Magnetic Bead Panel as per manufacturer’s instructions (Millipore Corporation). Concentrations for each cytokine were determined for all samples using the Bio-Plex 200 system (BioRad Laboratories Inc.).
-
bioRxiv - Cancer Biology 2021Quote: ... Target sequences (CTTCAACGTCTCTCAACAGAT #1 and CCGAGTTCTATGAGAACGACT#2) against human CD19 and a control scrambled sequence (CTCAATCAACAGATCTCGTCT) were inserted into the pLKO.1 vector (Sigma).
-
bioRxiv - Cancer Biology 2020Quote: RH30 and RH41 cells were transfected with 100nM of human DDX5 specific siRNA (siDDX5 #1 and siDDX5 #2, Sigma-Aldrich) or scrambled control siRNA (siCTR ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were washed then sequentially incubated with anti-SARS-CoV-2 CR3022 antibody (Yuan et al., 2020) (1 μg/mL) and a HRP-conjugated goat anti-human IgG (Sigma) in PBS supplemented with 0.1% (w/v ...
-
bioRxiv - Cancer Biology 2021Quote: ... All single-cell samples were distributed at 0.5×106 cells/mL for live staining with monoclonal mouse anti-human FOLR1 IgG1 (LS Bio) in DPBS with 2% v/v FBS (Sigma). Secondary staining for target was performed using QIFIKIT® (BIOCYTEX ...
-
bioRxiv - Microbiology 2021Quote: ... Parasite cultures were maintained in a sus-pension of human erythrocytes at 2% hematocrit in complete media (RPMI-1640, Millipore-Sigma, supplemented with 27mM sodium biocarbonate ...
-
bioRxiv - Microbiology 2021Quote: ... Parasite cultures were maintained in a sus-pension of human erythrocytes at 2% hematocrit in complete media (RPMI-1640, Millipore-Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... The infectious blood meal consisted of a 2:1 mix of washed human erythrocytes and viral suspension supplemented with 10 mM ATP (Sigma). The infectious titers were 107 FFU/mL for DENV-1 ...
-
bioRxiv - Immunology 2022Quote: ... expanded in the presence of recombinant human IL-2 (1000 U/mL, Proleukin) and rapamycin (50 nmol/L, Sigma-Aldrich), and transduced after 2 days ...
-
bioRxiv - Molecular Biology 2023Quote: ... Exponentially growing RPE-1 (human retinal pigment epithelial) cells were pulse-labeled with CldU (5-Chloro-2’-deoxyuridine, Millipore Sigma) and IdU (5-Iodo-2’-deoxyuridine ...
-
bioRxiv - Immunology 2022Quote: ... in mid-logarithmic phase was added at a multiplicity of infection of 2 in RPMI with 10% human serum (Sigma). Bacteria were spun down for 5 min at 800 x g and incubated for 1 h at 37 °C ...
-
bioRxiv - Immunology 2024Quote: ... Human PBMC were pre-activated with 30 ng/ml anti-CD3 (OKT3, Miltenyi) and 50 IU/ml IL-2 (Sigma) and subsequently transduced two times with viral supernatant in the presence of 6 ug/ml polybrene (Sigma ...
-
bioRxiv - Genomics 2021Quote: DNA from human keratinocyte cells was extracted using the “GenElute-Mammalian Genomic DNA Miniprep Kit” (Sigma) according to manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... Insulin concentrations after the 16 h hyperinsulinemia treatment were determined using human insulin RIA kit (Millipore). To mimic starvation ...
-
bioRxiv - Cancer Biology 2020Quote: ... Recombinant human EGF (Cat# E9644) and Glucose Quantification Kit (Cat# GAGO-20) purchased from Sigma-Aldrich; Cisplatin (Cat# 232120 ...
-
bioRxiv - Bioengineering 2019Quote: ... 100 µg/ml human recombinant Delta-1 or human IgG (Sigma) was added ...
-
bioRxiv - Immunology 2023Quote: ... Anti-human IgG HRP antibody (Anti-Human IgG-Peroxidase from Sigma) was diluted 1:30,000 in blocking buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... Cell lines stably expressing shRNA to human FBXO7 were generated as described previously (33-35) and selected with 2 µg/mL puromycin (Sigma-Aldrich). To vary glucose concentration ...
-
bioRxiv - Microbiology 2021Quote: Samples were diluted 1:2 in serum matrix for analysis with Milliplex Human Cytokine/Chemokine Magnetic Bead Panel as per manufacturer’s instructions (EMD Millipore Corporation). Concentrations for analytes (EGF ...
-
bioRxiv - Microbiology 2021Quote: ... 293T-ACE2 cells stably expressing human ACE2 are derived from 293T cells and were maintained in medium supplemented with 2 µg/mL of puromycin (Millipore Sigma) (Prévost et al. ...
-
bioRxiv - Cell Biology 2021Quote: HUVEC were seeded at 5×104 cells or 2×105 cells in 24-well plates on coverslips coated with 10 μg/ml fibronectin (from human plasma, Sigma Aldrich) and incubated overnight in complete EBM-2 medium ...
-
bioRxiv - Neuroscience 2021Quote: ... Cell lines stably expressing shRNA to human FBXO7 were generated as described previously (20) and selected with 2 μg/mL puromycin (Sigma-Aldrich).
-
bioRxiv - Biochemistry 2021Quote: The competitive inhibition of human fumarase activity in the presence of 2-amino-3-phosphonopropionic acid (AP-3, Sigma-Aldrich A4910) was fluorometrically assessed using a coupled enzyme assay ...
-
bioRxiv - Cancer Biology 2020Quote: ... All other cell lines were grown in Dulbecco`s modified Eagle medium (DMEM) (Fisher, UK) supplemented with 2% human serum (Sigma, UK) and maintained in an humidified sterile incubator with 5% CO2 at 37°C.
-
bioRxiv - Cell Biology 2021Quote: ... 250 µl of maintenance medium (50% Wnt3a-conditioned medium (ATCC#CRL-2647, Manassas, VA, USA) and 50% of 2× basal medium supplemented with recombinant human EGF (Sigma-Aldrich), recombinant human noggin (R&D Systems ...