Labshake search
Citations for Millipore Sigma :
51 - 100 of 420 citations for GSK3B siRNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... siRNA RAB27A (MISSION EHU091501, Sigma) targets human RAB27A ...
-
bioRxiv - Microbiology 2024Quote: siRNAs were synthesized by Sigma with the following designed sequences:
-
bioRxiv - Cell Biology 2019Quote: ... siRNA duplexes were used at the following concentrations: siRNA Universal Negative Control #1 (Sigma-Aldrich) and Mic10 (5’-CGGAUGCGGUCGUGAAGAUtt-3’ ...
-
bioRxiv - Cancer Biology 2020Quote: ... The siRNAs used for this study were NKX2-1 MISSION® siRNA (Sigma-Aldrich HS0100189848), PROX1 siRNA (Santa Cruz Biotechnology sc-106451) ...
-
African Swine Fever Virus CD2v protein promotes β-Interferon expression and apoptosis in swine cellsbioRxiv - Microbiology 2020Quote: ... PK15 cultures were transfected with CD58 siRNA (15 nM) and mission siRNA transfection reagent (Sigma) following the manufacturer’s protocol ...
-
bioRxiv - Physiology 2020Quote: ... or negative control siRNA using Mission siRNA transfection reagents (Sigma-Aldrich, St. Louis, MO, USA) for 48 h ...
-
bioRxiv - Cell Biology 2022Quote: siRNA control (siCtrl) and siRNA against the gene encoding MYSM1 were purchased from Sigma Aldrich. The RNAi nucleotides were transiently transfected in cells using jet-PRIME transfection reagent (Polyplus ...
-
bioRxiv - Cancer Biology 2024Quote: siRNA silencing was accomplished using forward transfection of pre-designed MISSION siRNAs from Sigma-Aldrich. A 10 nM final concentration of siBCAT1 (SASI_Hs01_00066058) ...
-
bioRxiv - Molecular Biology 2021Quote: ... b) PEI only without Bgpiwi siRNAs and c) Mission Universal mock siRNA/PEI complexes (Sigma Millipore). RNA was isolated as described above from washed transfected snails before utilizing for qPCR as described above ...
-
bioRxiv - Molecular Biology 2021Quote: ... b) PEI only without Bgpiwi siRNAs and c) Mission Universal mock siRNA/PEI complexes (Sigma Millipore). RNA was isolated as described above from washed transfected snails before utilizing for qPCR as described above ...
-
bioRxiv - Cancer Biology 2023Quote: ... and an siRNA Universal Negative Control were purchased from MISSION® Predesigned siRNA libraries (Sigma-Aldrich). Cells were transfected using JetPRIME transfection reagents (PolyPlus ...
-
bioRxiv - Immunology 2021Quote: ... siRNA against mismatch sequence (Sigma SIC001) was used as non-targeting control ...
-
bioRxiv - Molecular Biology 2021Quote: ... All siRNAs were purchased from Sigma and their sequences are listed in Supplementary Table 1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Transfections with Nr4a1 siRNA (nt1701; Sigma) were performed using Lipofectamine RNAiMax according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNAs were transfected with siImporter (Millipore) in OptiMEM medium (Life Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: ... to two different siRNAs (Sigma Millipore) (start on target sequence CDS position 2393bp-sense ...
-
bioRxiv - Molecular Biology 2021Quote: ... to two different siRNAs (Sigma Millipore) (start on target sequence CDS position 2393bp-sense ...
-
bioRxiv - Cancer Biology 2020Quote: ... All siRNAs were obtained from Sigma. At the time of transfection ...
-
bioRxiv - Cell Biology 2019Quote: ... All siRNA oligonucleotides were from Sigma Genosys UK.
-
bioRxiv - Cell Biology 2020Quote: ... siRNAs and MISSION esiRNAs (Sigma-Aldrich) were diluted in Opti-MEM to the opportune concentration and then added to the Lipofectamine emulsion at 1:1 ratio ...
-
bioRxiv - Cell Biology 2022Quote: ... The siRNAs were obtained from Sigma: Control ...
-
bioRxiv - Cell Biology 2022Quote: ... to transfect two siRNAs (Sigma-Aldrich) for each target mRNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... or negative control siRNA (SIC001, Sigma), was transfected into 60-70% confluent cells grown on 60 mm culture dish (1156F05 ...
-
bioRxiv - Cancer Biology 2022Quote: siRNA oligonucleotides were purchased from Millipore-Sigma to target the human SMYD3 mRNA (SASI_Hs02_0035-5988 ...
-
bioRxiv - Microbiology 2023Quote: All siRNAs were obtained from Sigma’s pre-designed siRNA library (see Supplementary Table 2 for specific siRNA reagents used) ...
-
bioRxiv - Cell Biology 2023Quote: ... VAPB siRNAs (GCUCUUGGCUCUGGUGGUUUU and AAAACCACCAGAGCCAAGAGC; Sigma) and ON-Target-plus nontargeting siRNA (D-001810-01-50 ...
-
bioRxiv - Cancer Biology 2023Quote: ... siRNAs for were purchased from Sigma as follows ...
-
bioRxiv - Molecular Biology 2023Quote: ... siRNAs were purchased from Sigma-Aldrich and transfected with Lipofectamine RNAiMAX (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2023Quote: ... the siRNAs were purchased from Sigma. The sequences for Ulk3 silencing were ...
-
bioRxiv - Physiology 2023Quote: ... RGS5 siRNA (ID: SASI_Hs01_00094781, Sigma-Aldrich) and control siRNA (sense ...
-
bioRxiv - Cancer Biology 2024Quote: ... siRNAs for were purchased from Sigma as follows ...
-
bioRxiv - Microbiology 2021Quote: ... The non-targeting control siRNAs (MISSION siRNA Universal Negative Control #1, SIC001) were purchased from Sigma Aldrich.
-
bioRxiv - Molecular Biology 2020Quote: ... The non-targeting control siRNAs (MISSION siRNA Universal Negative Control #1, SIC001) were purchased from Sigma Aldrich.
-
bioRxiv - Microbiology 2023Quote: ... The non-targeting control siRNAs (MISSION siRNA Universal Negative Control #1, SIC001) were purchased from Sigma Aldrich.
-
bioRxiv - Cell Biology 2019Quote: Cells were transiently transfected with 100 nM of siRNA constructs or a non-related siRNA (siScramble) (Sigma-Aldrich) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: Control siRNA (siRNA scr) (siRNA Universal Negative Control #1 SIC001) and human GPC3 siRNA (NM_004484; SASI_Hs01_00205845) were purchased from Sigma-Aldrich and used at a concentration of 50 nM ...
-
bioRxiv - Cancer Biology 2021Quote: ... All siRNAs were purchased from Sigma-Aldrich and listed in table S3 ...
-
bioRxiv - Cell Biology 2019Quote: ... was purchased from Sigma and MISSION® siRNA Universal from Sigma was used as a negative siRNA control.
-
bioRxiv - Cell Biology 2020Quote: ... and Xtreme Gene siRNA transfection agent (Sigma)) to determine the optimal transfection conditions for each cell line ...
-
bioRxiv - Cell Biology 2020Quote: ... or a negative control siRNA (Sigma Aldrich, MISSION siRNA Universal Negative Control #1 ...
-
bioRxiv - Neuroscience 2020Quote: ... or negative control siRNA (SIC001-5X1NMOL, Sigma) were applied according to the experimental design in Figure 12H ...
-
bioRxiv - Molecular Biology 2020Quote: All siRNAs were synthesized by Sigma-Aldrich. The 293T cells co-transfected with 80 pmol of the indicated siRNA and 1 μg of the indicated constructs using Lipofectamine 3000 without P3000 reagent ...
-
bioRxiv - Cancer Biology 2019Quote: siRNA constructs targeting LPL or VLDLR (Sigma) were transfected into MDA-MB-231 BC cells using Lipofectamine RNAiMAX (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... The siRNA targeting VPS35 was from Sigma (5’ CTGGACATATTTATCAATATA 3’ ...
-
bioRxiv - Molecular Biology 2020Quote: ... siH2AZ (siRNA) were purchased from Sigma Aldrich. siH2AZ and negative control (NC ...
-
bioRxiv - Cell Biology 2021Quote: ... and siRNAs by using oligofectamine (Sigma-Aldrich) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... A siRNA against firefly luciferase (Sigma Aldrich) or scrambled LNA GapmeR (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... or small interfering RNAs (siRNAs; Sigma Aldrich) using Lipofectamine RNAiMAX (Life Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... we transfected commercially available siRNAs (Sigma-Aldrich) using ScreenFect A Transfection Reagent (Wako Pure Chemical Industries ...
-
bioRxiv - Genetics 2021Quote: siRNA duplexes were obtained from Sigma-Aldrich or Dharmacon (Supplementary Table S2 ...